Extended Data Fig. 7: Comparison of CRISPR/Cas9 editing efficiency in LAB and QLD.
From: A multi-omic Nicotiana benthamiana resource for fundamental research and biotechnology
(a) The basic editing construct (with kanamycin selection) used to transform LAB or QLD tissues. The two guide (g)RNA sequences were placed between the tRNA processing units (indicated as spacer sequences 1 & 2 in panel A). Two sites were chosen within the same target gene, usually ~200 nucleotides apart, and gave either a dropout of the intervening DNA sequence in the genome or inaccurate repair of one or both sites. (b) Phenotypes of QLD knockouts (ko) of RDR1 infected with Tobacco mosaic virus (TMV), RDR6 and Phytoene desaturase (PDS) and LAB knockout of RDR2. Silencing of PDS in QLD targeted two homoeologs simultaneously to give biallelic silencing of both genes in the T0 generation. gRNA sequences used: RNA-dependent RNA polymerase (NbRDR1): TAAATAGTACAGTTTCTCCA; GACACTCAAAGTTTCTCTGG. NbRDR2: CCACTCCCAACGTAGATAAG; GTGTCTCGAAATGTGCTGCA. NbRDR6: CTTACTTAGAAGTCATCAGG; CTGCAACAGTATTACCAAAG. Phytoene desaturase (NbPDS) TCACAAACCGATATTGCTGG; GAGCTTCAGGAAAATCAAAG. (c) Comparison of editing efficiency of LAB and QLD. Editing efficiency in LAB and QLD was determined using the NbRDR genes involved in RNAi.
