Fig. 1: microRNAs are pseudouridylated in plants and mammals.
From: Pseudouridine guides germline small RNA transport and epigenetic inheritance
a, BiFC confirming interaction of AGO3 with the DSKC1 cofactor NHP2 in Arabidopsis (Methods). Split yellow fluorescence protein (YFP) was fused to the C and N termini or both N termini of AGO3 and NHP2. Reconstituted YFP signifies interaction. p35S::RFP (red fluorescence protein) acted as a transformation control. b, Volcano plot showing proteins copurified with GFP-tagged NHP2 compared to IP performed in WT plants. NHP and AGO family proteins are depicted in orange (n = 3 biological replicates; statistical significance was calculated using edgeR (Methods); P value was adjusted by Benjamini–Hochberg correction). c, Structure of uridine and Ψ, enzymes involved in catalysis and methods of detection with specific antibodies and chemical modification with CMC (Methods and Extended Data Fig. 2). d, Volcano plot of miRNAs enriched by Ψ-IP compared to unbound fractions from Arabidopsis flower buds. Blue dots, significantly enriched or unbound miRNAs (adjusted P < 0.01); orange, both Ψ-IP enriched and depleted from libraries following CMC treatment (adjusted P < 0.01); dark red, not significant. Statistical significance was calculated using DESeq2; P value was adjusted by Benjamini and Hochberg method (n = 5 biological replicates). e, Venn diagram showing overlap of miRNAs detected in flower buds by each technique. Predicted Ψ sites in miRNAs detected by all three techniques. f, miRNAs enriched by Ψ-IP in WT and dkc1 mutants in Arabidopsis leaves. Error bars indicate the s.e.m. of log2(fold change) estimated by DESeq2; n = 3 WT and n = 4 dkc1 biological replicates. g, Metaplot of modification frequency of miRNAs at each site based on proximity to the 5′ or 3′ end determined by CMC/Mn2+ sequencing. h, Northern blots of three synthetic 21-mer oligoribonucleotides (sequence: UGACACAGGACUACGGACGUAU) either unpseudouridylated or pseudouridylated at position 10 or 21, treated (+) or mock-treated (−) with CMC and probed with a matching DIG-labeled probe (representative image of three independent experiments). i, Flower bud small RNA treated (+), mock-treated (−) or untreated (no mock treatment) with CMC and probed with miR159b to reveal mobility shifts (representative image of four independent experiments).
