Human cancer-targeted immunity via transgenic hematopoietic stem cell progeny

Nowicki, Theodore S.; Deen, Nataly Naser Al; Peters, Cole W.; Comin-Anduix, Begoña; Medina, Egmidio; Puig-Saus, Cristina; Carretero, Ignacio Baselga; Kaplan-Lefko, Paula; Macabali, Mignonette H.; Garcilazo, Ivan Perez; Chen, Daniel; Pang, Jia; Berent-Maoz, Beata; Haile, Salem; Rodriguez, Jonathan; Kawakami, Moe; Kidd, Conner K.; Champhekar, Ameya; Carlucci, Giuseppe; Vega-Crespo, Agustin; Chmielowski, Bartosz; Singh, Arun; Federman, Noah; Schiller, Gary M.; Larson, Sarah J.; Allen-Auerbach, Martin; Klomhaus, Alexandra M.; Zack, Jerome; Baltimore, David; Yang, Lili; Kohn, Donald B.; Witte, Owen N.; Ribas, Antoni

doi:10.1038/s41467-025-60816-z

Download PDF

Article
Open access
Published: 01 July 2025

Human cancer-targeted immunity via transgenic hematopoietic stem cell progeny

Nature Communications volume 16, Article number: 5599 (2025) Cite this article

Subjects

Abstract

Adoptive transfer of genetically engineered T cells expressing a tumor-antigen-specific transgenic T cell receptor (TCR) can result in clinical responses in a variety of malignancies. However, these responses are frequently short-lived, and patients typically relapse within several months. This phenomenon is largely due to poor persistence of the transgenic T cells, as well as a progressive loss of their functionality and terminal differentiation in vivo. This underscores the need for cell therapy approaches able to sustain the initial antitumor efficacy and lead to long-term antitumor efficacy. Herein, we report the use of tandem cell therapies involving autologous T cells and hematopoietic stem cells engineered to express the NY-ESO-1 TCR for the treatment of solid tumors in a first-in-human phase I clinical trial (NCT03240861). This therapy is shown to be safe, feasible, and leads to initial tumor regression activity. T cell progeny from the HSC progenitors is shown to provide circulating transgenic NY-ESO-1 TCR-T cells, which display tumor-antigen-specific antitumor functionality, without any evidence of anergy or exhaustion. These results demonstrate the utility of transgenic HSCs to generate a self-renewing source of tumor-specific cellular immunotherapy in human participants. Clinicaltrials.gov: NCT NCT03240861

Defined tumor antigen-specific T cells potentiate personalized TCR-T cell therapy and prediction of immunotherapy response

Article 14 February 2022

TCR-engineered T cells targeting E7 for patients with metastatic HPV-associated epithelial cancers

Article 08 February 2021

Promises and challenges of adoptive T-cell therapies for solid tumours

Article Open access 29 March 2021

Introduction

Immunotherapy with T cells genetically engineered to express a tumor antigen-specific transgenic T cell receptor (TCR) has enabled the treatment of some solid tumors, mainly metastatic sarcoma, melanoma, and human papilloma virus (HPV) positive cancers^1,2,3,4,5,6. This therapeutic approach has been shown to induce objective tumor regression in a large proportion of patients. However, these initial responses are often not sustainable, and patients frequently relapse within 6–12 months following the initial cell infusion^1,2,3,4,5,6. This phenomenon underscores the need for better cell therapy approaches to sustain the antitumor efficacy and lead to durable disease control and remission. Previous work by our group and others has shown that transgenic cell therapies are often associated with decreases in transgenic T cell persistence over time^3,4,7. Furthermore, the persisting transgenic T cells themselves often acquire a hypofunctional terminal effector and exhausted phenotype, which coincides with their loss of therapeutic efficacy and cancer progression^3,8. These phenomena collectively underscore the need for therapeutic approaches that can overcome these weaknesses by enhancing the persistence of transgenic T cells with highly functional antitumor activity in order to provide sustained therapeutic efficacy.

Given the weaknesses in traditional modalities of transgenic TCR-T cell therapy, we developed a novel approach to these treatments. Previous studies have shown that TCR-transduced hematopoietic stem cells (HSCs) endogenously differentiate into fully active mature T cells in animal models^{9,10,11,12,13}. However, there is a delay in the appearance of such T cells in peripheral circulation. Therefore, we designed a phase I clinical trial for patients with advanced solid tumors expressing the tumor antigen NY-ESO-1, a pan-cancer antigen expressed in a wide variety of solid tumors (predominantly sarcomas), but generally not within any normal somatic tissues. In the present study, in an effort to potentiate the therapeutic efficacy of traditional TCR-T cell therapeutics, we delivered a tandem adoptive cell therapy of transgenic NY-ESO-1 TCR autologous T-cells along with autologous HSCs expressing the same transgenic NY-ESO-1 TCR after a reduced-intensity myeloablative and lymphoablative chemotherapy conditioning regimen¹⁴. Furthermore, the HSC product was engineered to co-express a modified herpes simplex virus (HSV) thymidine kinase 1 (sr39TK), which allowed for both the non-invasive tracking of progeny derived from gene modified peripheral blood stem cells (PBSC) to assess their biodistribution as well as functioning as a suicide gene to ablate the transgenic cells in the event of unanticipated toxicity^13,15.

In the present study, we report that tandem therapy with both transgenic T-cells and HSCs encoding the NY-ESO-1 TCR is safe, feasible, and provides an initial wave of antitumor activity arising from the traditional TCR transduced T cell product, after which the T cell progeny from the HSC niche are shown to provide circulating transgenic NY-ESO-1 TCR T cells which display specific NY-ESO-1 antigen-dependent antitumor functionality, the first such instance of this approach being successfully utilized in human subjects. We also report the first successful use of the suicide/reporter gene sr39TK to detect and monitor in vivo engraftment of transgenic hematopoietic stem cells in human subjects. These results have implications for the design of future iterations of transgenic cell therapy for the treatment of solid tumors and other conditions.

Results

Patient enrollment, manufacture, and administration of transgenic TCR peripheral T-cell and hematopoietic stem cell products

Patients with relapsed or refractory metastatic solid tumors and the following criteria were considered for enrollment in the trial: NY-ESO-1-positive tumors as demonstrated by immunohistochemistry; HLA-A:02:01 status as demonstrated by high-resolution molecular phenotyping; disease progression with standard-of-care treatment options for their metastatic or locally advanced cancer; adequate clinical performance status; and evidence of measurable disease and fulfilling eligibility criteria. These participants were considered for an initial mobilized leukapheresis at UCLA, during which they received filgrastim (granulocyte colony-stimulating factor) and plerixafor (anti-CXCR4) to mobilize and collect PBSCs. CD34+ cells were isolated using automated magnetic separation and cell sorting and were then resuspended in serum-free medium with supplemental cytokines SCF, FLT3L, TPO, and IL-3. The cells were cultured for 18 ± 6 h prior to transduction with a clinical-grade lentiviral vector encoding the NY-ESO-1 TCR and the HSV-sr39TK gene. This latter feature allowed for both non-invasive in vivo imaging of the transgenic HSCs via 9-4-[18 F]fluoro-3-(hydroxymethyl)butylguanine ([18 F]-FHBG) positron emission tomography–computed tomography (PET/CT)^{16,17,18,19,20,21,22}, as well as a potential target for ablation in the event of any toxicities resulting from the HSC product¹³. Following lot release testing of the transduced HSC product, patients underwent a non-mobilized leukapheresis to collect peripheral blood mononuclear cells (PBMCs), and were admitted to the hospital for conditioning chemotherapy with 70,000–80,000 ng/mg*hr of busulfan and 40 mg/m2/day of fludarabine (days −5 thru −2)²³. In parallel, their PBMCs were transduced with a retroviral vector encoding the NY-ESO-1 TCR. Transgenic PBSCs were infused on day 0, and transgenic PBMCs were infused on day +1, followed by low-dose IL-2 (500,000 IU/m2) administered subcutaneously twice daily on days +2 through +8 as tolerated. Manufacturing protocols and cell infusion timelines are summarized in Fig. 1. Five patients enrolled in the clinical trial, and three received both cellular therapy infusions; their manufacturing and therapeutic outcomes are summarized in Table 1 and Supplementary Tables 1 and 2. Two patients who had consented did not receive the double cellular therapy: subject NYSCT-02 was unable to mobilize sufficient CD34+ PBSCs despite repeated mobilization attempts, while subject NYSCT-04 developed a malignant pleural effusion requiring indwelling chest tube for drainage shortly before his mobilized leukapheresis, and withdrew from the study.

**Fig. 1: Overview of manufacturing protocol, and clinical trial procedures.**

Table 1 Patient demographics and outcomes

Full size table

Assessment of safety, feasibility, and efficacy

There were no grade 3 or greater adverse events attributed to the autologous NYESO-1 TCR/sr39TK transgenic HSCs, while one grade 3 adverse event (hypotension) was graded as possibly related to the retroviral modified NYESO-1 TCR PBMCs. The investigational cell therapy agents were both able to be administered safely and feasibly. Adverse events are summarized in Supplementary Data 1. While there were multiple grade 4 adverse events attributed to the conditioning chemotherapy and resultant immunosuppression, there were no grade 3 or greater adverse events attributed to the autologous NYESO-1 TCR/sr39TK transgenic HSCs. The incidence of adverse events relating to conditioning chemotherapy agents (busulfan and fludarabine) was consistent with the significant and prolonged pancytopenias, which are often associated with the use of these agents in the setting of autologous HSC transplant procedures and adoptive cell therapy protocols. Of the patients who ultimately received therapy, two (NYSCT-03 and NYSCT-05) demonstrated reduced tumor size in response to therapy (Supplementary Fig. 2), while one patient did not show an objective clinical response to therapy (NYSCT-01).

Subject NYSCT-03 developed Grade 4 hypoxia on day +62, which was found to be due to cytomegalovirus (CMV) pneumonitis. Subject was CMV-negative by serology pre-treatment, and had persistently negative CMV serum PCRs post-treatment, so this was deemed to represent a de novo infection and not a reactivation. Subject’s CMV was refractory to treatment with multiple antiviral agents, and she passed away on day +76. Subject NYSCT-05 experienced Grade 3 malignant pleural effusion requiring chest tube placement and admission to the hospital for observation on day +92, which was determined to be related to disease progression.

Visualization of transgenic HSC niche in vivo correlates with persistence of lentiviral progeny in circulation

Peripheral blood samples were obtained weekly through day +28, and biweekly thereafter. Isolated PBMCs were monitored for transgenic TCR-T cell persistence via flow cytometry and interrogation for both retroviral and lentiviral vector presence via ddPCR. Differences between viral vectors allowed delineation between TCR-T cells that were derived from the initial PBMC infusion product or from the transgenic HSC niche (Supplementary Fig. 3). Patients underwent PET scans with the experimental tracer [18 F]-FHBG on approximately day +30 and day +120 in order to visualize the transgenic HSCs and correlate with the findings in peripheral circulation. The sr39TK protein phosphorylates an experimental PET reporter probe, [18 F]-FHBG, upon IV administration. [18 F]-FHBG, a radiolabeled analogue of penciclovir, becomes trapped in the sr39TK-expressing PBSCs and progeny T cells upon phosphorylation and is detectable by PET imaging²⁴. 7–7.5 mCi of [18 F]-FHGB was injected for each PET/CT scan for determination of sr39TK transgenic HSCs. The normal biodistribution of [18 F]-FHBG does not demonstrate significant uptake in bone marrow or splenic tissue²⁴. Visual assessment was used for evaluation of the Day +30 and Day +120 post-transplant scans available for the patients. In addition, volume of interest (VOI, 1 cm³) of representative marrow (L5 vertebra) and splenic regions was placed, and the maximum standardized uptake value (SUV_max) and SUV_peak were calculated for all scans (Supplementary Table 3). Subject NYSCT-03 passed away prior to the day +120 timepoint, while subject NYSCT-05 displayed no engraftment at day +30, so no day +120 scan was performed on either of these subjects.

Although each subject demonstrated different success rates with the engraftment of the transgenic HSCs, these results were consistent with our overall hypothesis regarding the generation of functional lentiviral TCR-T cell progeny from the HSC niche. NYSCT-01 demonstrated only very modest expansion of the transgenic TCR-T cells (Fig. 2A, B), which was attributed to suboptimal lymphodepletion with fludarabine (30 mg/m2/day on days −4 and −3), given that the busulfan is specifically myeloablative for CD34+ HSCs. The protocol was therefore modified, and the next patients NYSCT-03 and NYSCT-05 received higher doses of fludarabine, resulting in superior peripheral lymphodepletion (Supplementary Fig. 4) and subsequent in vivo expansion of the transgenic TCR-T cells. The post-transplant [18 F]-FHBG PET scans for NYSCT-01 demonstrated initially robust engraftment and consequent visualization of the lentiviral transgenic HSCs by day +29, but showed loss of engraftment at the next scan on day +120 (Fig. 2C, D). Consistent with this finding, NYSCT-01 demonstrated an initially retroviral-predominant signature in PBMCs (owing to the retroviral TCR-T cell infusion), which was then superseded by lentiviral-predominant PBMC signatures coinciding with the engraftment of lentiviral-transduced HSCs and their corresponding progeny (Fig. 2A, B). However, lentiviral progeny were subsequently undetectable by day +120, which was consistent with the loss of transgenic HSCs noted at that point by the corresponding [18 F]-FHGB PET. Of note, no patients’ PBMCs demonstrated significant increase in auto/allo-reactivity (as measured by interferon-gamma release assay) following co-culture with their own PBSCs due to the presence of the sr39tk gene (Supplementary Fig. 5). Conversely, subject NYSCT-05 showed robust expansion of TCR-T cells in vivo (Fig. 3A), which was an initially retroviral-predominant PBMC population, but never displayed any detectable lentiviral progeny within the PBMC niche (Fig. 3B). Consistent with this finding, no detectable engraftment at day +35 as visualized via [18 F]-FHGB PET scan for NYSCT-05 (Fig. 3C). This was attributed to the borderline transduction efficiency of that patient’s transgenic HSC preparation, although this was still within the lot release criteria parameters (Supplementary Table 1). Consistent with this finding,

**Fig. 2: Retroviral and lentiviral-transduced cell engraftment kinetics in patient NYSCT-01.**

**Fig. 3: Retroviral and lentiviral-transduced cell engraftment kinetics in patient NYSCT-05.**

TCR transgenic progeny from genetically modified HSC niche demonstrates antigen-specific anti-tumor functionality

NYSCT-03, like NYSCT-01, demonstrated an initially retroviral-predominant signature within the expanding transgenic TCR PBMC precursors, which was superseded by lentiviral signature concomitantly with the engraftment of transgenic HSCs (Fig. 4). However, the PBSC transplant within patient NYSCT-03 engrafted and showed continued expansion up to day +43 after transplantation, unlike NYSCT-01 whose PBSC engraftment had begun to decline after day +30. To further assess the functional engraftment of the lentiviral cell product, we subjected the patient’s day +43 PBMCs to joint single nuclei RNA sequencing (snRNAseq) and assay for transposase-accessible chromatin (ATACseq), which allows to determine chromatin accessibility across the genome along with the whole transcriptome sequencing from the same nucleus, we confirmed that there were very few cells containing retroviral signature (~0%), while a substantial fraction of the nucleated cells contained lentiviral signatures (46.9%), indicating that they were derived from the transgenic HSC progenitors (Fig. 5A–C). These lentiviral-positive PMBCs (pos_pLenti) represented a diverse range of nucleated myeloid and lymphoid cell types, including a range of different T cell phenotypic subtypes, as shown by the different cell types and cell states (Fig. 5D–E).

**Fig. 4: Retroviral/lentiviral engraftment kinetics in patient NYSCT-03.**

**Fig. 5: Single nuclei RNA sequencing (snRNAseq) of PBMC from patient NYSCT-03 at day 43.**

To assess whether the PBSC cell products, which give rise to T cell progeny, would ablate normal TCR expression and thus reduce T cell repertoire reconstitution, we also analyzed snRNAseq data in T cell subtypes for TCR expression. The lentiviral-positive T cells (pos_pLenti) from peripheral blood demonstrated some degree of allelic exclusion of the native TCR locus, consistent with previously reported studies of this system in murine models²⁵, although this phenomenon was not complete. While the lentivirus-positive CD4 T cell clusters demonstrated ~45% co-expression of both the lentiviral NY-ESO-1 TCR (pRRL-lenti) and genomic TRBC1/2, only 15.4% of CD8 T cell clusters co-expressed the lentiviral NY-ESO-1 TCR along with the native genomic TRBC2, without TRBC1. The remainder of the CD4 and CD8 T cell clusters had only lentiviral NY-ESO-1 TCR expression detected (Fig. 5F–J). Taken together, these results demonstrated that the transgenic lentiviral TCR-T cell progeny were able to arise from the transgenic HSCs, as we had initially hypothesized, with some incomplete degree of allelic exclusion demonstrated by co-expression of transgenic and genomic TCRs within the T cell clusters.

Of note, focusing on the pLenti+ and pLenti- CD8 T-cell populations showed no difference in anergy and exhaustion markers expression in the CD8 T-cells across the pLenti+ and pLenti- cells (Supplementary Fig. 6A, B). Looking into the top 100 differentially expressed genes between pLenti+ and pLenti- CD8 T-cells did not reveal key transcriptional differences between the two CD8 T-cell populations. Although CD80 appeared to be upregulated in a few pLenti+ CD8 T-cells (only 3 out of 24 cells) as compared to the pLenti- CD8 T-cells, we suspect that the pLenti+ CD8 T-cells are new progeny that wouldn’t have had the chance to undergo thymic selection (Supplementary Fig. 6C).

Finally, we sought to assess the antigen-dependent functionality of these lentiviral HSC-derived TCR-T cells. When we stimulated these cells from the day +43 PBMC sample from NYSCT-03 with the human melanoma cell line M257-A2, which is NY-ESO-1-positive and HLA-A:02:01-positive, we found significant elevations in secreted interferon-gamma, compared to the T cells cultured alone or with M257 cells, which are positive for NY-ESO-1 but negative for HLA-A:02:01 (Supplementary Fig. 7). Taken together, these results demonstrated that the transgenic lentiviral TCR-T cell progeny arising from the transgenic HSCs displayed antigen-specific cytokinetic functionality, consistent with our fundamental hypothesis of the mechanism of action of this therapy.

Discussion

Transgenic adoptive cell therapy approaches for solid tumors are an effective form of cancer immunotherapy, with a wide variety of targets. However, their lack of persistent anti-tumor activity stands in stark contrast to their frequent and initially potent early objective clinical responses, including in recently FDA-approved cell therapies for solid tumors, such as afamitresgene autoleucel²⁶. This widespread finding underscores the need to improve the persistence of the early anti-tumor activity of the transgenic T cells. Given that our group and others have shown that the persistence and progressive terminal differentiation of the adoptively transferred T cells coincides with the loss of their therapeutic efficacy^3,8,27, along with the previously demonstrated ability of transgenic TCR HSCs to generate transgenic progeny in peripheral circulation in murine models^9,10,12, we sought to test this approach in a first-in-human trial with a tandem transfer of a transgenic HSC product along with the traditional transgenic TCR-T cell product.

The ability of the transgenic HSC precursors to generate progeny containing the NY-ESO-1 TCR vector insert is consistent with previous studies incorporating this technique to replace missing or deficient enzymes in the setting of primary immunodeficiencies. In such studies, the transgene was present in all nucleated progeny arising from the transgenic marrow and demonstrated functional persistence of expression for years following administration of the autologous gene-modified product^28,29. Lentiviral vectors utilized in this capacity have also demonstrated a degree of persistence and safety superior to that of retroviral vectors^30,31,32,33, which have been associated with both transformation-induced malignancies^31,34 and epigenetic silencing of the retroviral vector’s expression^35,36. While using this approach to both generate functional TCR transgenic T cells arising from the HSC niche and utilizing the sr39TK gene as an in vivo visualization has been shown in animal models^9,10,12, this represents the first time that either technique has been effectively demonstrated in human subjects. Our single-cell data showed the expected presence of the transgenic TCR within all lineages interrogated; however, it is unlikely that any expression of TCR protein in a non-T cell would lead to any antigen-specific activities, given that these cells would lack the other underlying intracellular components necessary to effectuate a TCR-driven response.

Given the long-term persistence and functionality of other lentiviral-modified HSC products’ transgenes, it is possible that our approach would have resulted in the sustained generation of functional transgenic TCR-T cells capable of engaging with the NY-ESO-1 tumor antigen. Although previous studies have cast doubt on the ability of HSC-derived CAR-T cells to survive thymic selection³⁷, both our current data and our previously published experiences with NY-ESO-1 TCR-T cell therapies have demonstrated that most subjects have low-level, but detectable levels of circulating NY-ESO-1 TCR clones prior to TCR transduction^3,38. This implies that NY-ESO-1 is sufficiently antigenic as to generate TCR clones which survive thymic selection, albeit with a target which is insufficiently antigenic as to generate a robust clonal response. Given that we are using such a TCR as is present in endogenous settings, we would speculate that this would be a potential advantage in using a TCR instead of a CAR. However, the logistical considerations of this therapy, coupled with the inherent clinical precariousness of patients with aggressive sarcomas, limited our ability to examine how these products would have gone on to equilibrate long-term, and may ultimately limit the wider therapeutic efficacy of this approach.

The difficulty in both initiating and maintaining the therapeutic efficacy of this therapy, even in the context of demonstrated functional progeny arising from the HSC niche, underscores the inherent risks of an autologous stem cell transplant as a component of refractory sarcoma treatment. While autologous stem cell transplant has been utilized in the setting of high-dose chemotherapy consolidation (with autologous stem cell rescue) for high-risk Ewing’s sarcoma and desmoplastic small round blue cell tumors, these approaches are associated with significant toxicities beyond those encountered with conventional chemotherapy^39,40. Given the death of subject NYSCT-03 due to a de novo CMV infection during immunologic reconstitution (despite the generation of functional transgenic T cell progeny from the transgenic HSCs), as well as the evidence of partial allelic exclusion in the patient’s T cells arising from the transgenic HSCs, the risks inherent to our approach may ultimately outweigh the therapeutic benefit. Indeed, we were also prevented from obtaining on-treatment tumor biopsy samples for analysis from this patient owing to her clinical instability following her initial tumor regression, which also limited our ability to derive additional conclusions regarding the in vivo activity of the T-cell progeny derived from the transgenic HSCs. Furthermore, the inability of subject NYSCT-02 to mobilize sufficient CD34+ PBSCs, as well as NYSCT-04 withdrawing prior to mobilization due to rapid disease progression, underscores the burden of both heavy pre-treatment chemotherapy and the inherent medical fragility of patients with relapsed/refractory sarcoma. Given that our approach required a 28-day wash-out period, as well as several weeks to allow for the transgenic PBSC manufacture, the logistics of a treatment modality involving transgenic HSCs may preclude the treatment of medically fragile patients with heterogeneous relapsed or treatment-refractory sarcomas, further limiting its broader clinical utility.

The reason for the initial engraftment and subsequent loss of the transgenic HSCs in subject NYSCT-01 was unclear, although possibilities include poor long-term persistence of the transgenic HSCs, or T cell-mediated rejection of the transgenic marrow. If the latter possibility were the mechanism of graft loss, the sr39TK reporter/suicide gene could be a potential cause for this. While the potential immunogenicity of the native HSV-TK protein has been shown in T cell products^41,42 it has not been shown to occur in the context of using sr39TK in HSC transduction¹². Furthermore, our own co-culture experiments with patient-matched PBMCs with transduced and untransduced PBSCs did not result in any significant reactivity as measured by interferon-gamma release.

Despite the clinical difficulties in utilizing a stem-cell-based therapeutic in patients with advanced sarcomas, this represents the first instance of successfully generating functional clonal transgenic T cell progeny from lentiviral-transduced HSCs. The implications for such success can be applied to a multitude of other diseases. The use of genetically modified HSCs has been proposed to generate antigen-specific T cells directed against HIV-1 infection, and has been validated in preclinical models^43,44,45. Furthermore, the use of this approach to generate long-term chimeric antigen receptor (CAR) T cell or invariant natural killer T (iNKT) cell progeny has also been explored in preclinical models^46,47,48. It is possible that the patient populations of other potential disease indications, such as those with HIV-1 infection, would not have the burdens of heavy chemotherapy pre-treatment history or rapidly progressive malignancy, and could be more suitable for such genetically engineered HSC-based immunotherapies than our target patient population. Furthermore, the use of a CAR construct might avoid the partial allelic exclusion phenomenon observed both in preclinical studies utilizing a TCR-transduced HSC therapy, as well as our own. However, the unknown impact of such CAR expression on all HSC-derived progeny underscores the need for continued use of suicide gene systems as a safety feature in any such future studies.

In conclusion, the administration of dual cell therapy with retroviral transgenic TCR-T cells and lentiviral transgenic TCR HSCs in three subjects was safe and feasible, with no significant adverse events attributed to the cell therapy products. Visualization of transgenic HSCs via [18 F]-FHGB in human subjects was effective in tracking successful engraftment. Lentiviral TCR-T cell progeny arising from the transgenic HSC niche demonstrated NY-ESO-1 antigen-specific cytokinetic functionality, as well as a significant degree of allelic exclusion. Points for improvement of this therapeutic modality include improvements in transduction efficiency of the lentiviral HSC product, mitigation of risks from opportunistic infections, and subject selection, given the medical fragility of patients with sarcoma and the time needed to enroll and treat patients with this therapy. Given the preclinical data demonstrating the use of gene-modified HSCs to generate CAR-T cell or iNKT cell products, as well as TCRs directed against non-cancer antigens, such as HIV-1, future iterations of this immunotherapy modality could be expanded to include a diverse range of therapeutic indications.

Methods

Study ethics and conduct

Patients were enrolled in the clinical protocol after signing a written informed consent approved by the UCLA Institutional Review Board (#15-000511) under investigational new drug designations for the NY-ESO-1 TCR (IND#17471 and #15167) and the 9-4-[18 F]fluoro-3-(hydroxymethyl)butylguanine ([18 F]-FHBG) PET tracer (IND# 135251). The study was conducted in accordance with local regulations, the guidelines for Good Clinical Practice, and the principles of the Declaration of Helsinki. The study had the clinical trial registration number NCT03240861, and this is the final report of this study. Use of human specimens from this trial was also approved by the UCLA Institutional Review Board under the above protocol number.

Trial eligibility and screening procedures

Eligible patients were HLA-A*0201 by high-resolution molecular phenotyping, with locally advanced or metastatic solid tumors, and with either no available standard therapeutic options with curative intent, or progression on standard-of-care chemotherapy or radiotherapy regimens. Tumors were NY-ESO-1 positive by immunohistochemistry. Patients were >18 years of age, with a life expectancy of >3 months, an ECOG performance status of 0 or 1, adequate organ function required to receive systemic IL-2⁴⁹, and seronegative for Hepatitis B/C, and HIV. Patients with clinically active brain metastases were excluded. More than four weeks had elapsed since any prior systemic steroid use or cancer therapy.

Cell manufacturing processes and treatment schedule

The manufacture and treatment schedule is outlined in Fig. 1. Patients underwent mobilized leukapheresis for the manufacture of the NY-ESO-1 TCR/sr39TK transgenic PBSCs. Patients self-administered filgrastim (Neupogen, Amgen, Thousand Oaks, CA; 10 µg/kg/day) for four days prior to the leukapheresis, and a 20 mg dose of plerixafor (Mozobil, Sanofi, Paris, France) the evening before leukaphersis. A minimum of 5 × 10⁶/kg body weight of CD34+ cells, as determined by clinical flow cytometry, was required prior to initiating manufacturing procedures.

Following harvest, CD34+ HSCs were purified, cultured, and transduced in the UCLA Good Manufacturing Practices facility, using standard CliniMACs® cell purification protocols and seeded into fresh closed cell culture bags or flasks in serum free medium (X-VIVO-20, Lonza, Basel, Switzerland) supplemented with 1% human serum albumin (Baxter), and cytokines SCF (300 ng/mL), Flt-3 ligand (300 ng/mL), TPO (100 ng/mL) and IL-3 (20 ng/mL) at a density of 0.5 to 1 × 106/mL. All cytokines (Peprotech, Cranbury, NJ) and culture reagents were approved for ex vivo clinical use. A small culture sample was removed for sterility testing. After ~18 h total pre-stimulation, cells were cultured with the NY-ESO-1 TCR/sr39TK LV (Supplementary Fig. 1A, Supplementary Data 2) (Indiana University Vector Production Unit, Indianapolis, IN) for ~20 h in the same complete medium at a cell concentration of 0.5 to 1 × 106 cells/mL. Following transduction, a portion of cells were removed for quality control i.e., analysis of transduction efficiency (via flow cytometry, colony-forming assay, and ddPCR), viability, sterility, and replication-competent lentivirus. Full details of in-process testing and lot release testing are available in Supplementary Table 4 and Supplementary Data 3. Following lot release testing, the remaining cells were washed and resuspended in CryoStor® CS5 (BioLife, Bothell, WA) for cryopreservation prior to administration.

Patients underwent an unmoblized leukapheresis for PBMC isolation for the manufacturing of the NY-ESO-1 TCR transgenic T cells, which were manufactured as previously described³. Briefly, unselected PBMC were isolated by Ficoll gradient centrifugation and cultured in AIM V media (Gibco, Invitrogen, Chicago, IL) supplemented with 5% human AB serum (Omega Scientific, Tarzana, CA) in the presence of 50 ng/mL anti-CD3 (OKT3, Miltenyi Biotec, Auburn, CA) and 300 IU/mL IL-2 in order to stimulate T cell growth to prepare for viral vector transduction. Activated PBMC were infected by the clinical grade MSGV1-A2aB-1G4A-LY3H10 retroviral vector (Supplementary Fig. 1B and Supplementary Data 4) supernatant using retronectin-coated plates (NYSCT-01) or bags (NYSCT-03, NYSCT-05) (Retronectin, Takara, Otsu, Shiga, Japan) for two consecutive days, maintained in culture for 4 days from the start of transduction in IL-2, and then infused fresh into trial subjects. Aliquots of these cells were used to fulfill the lot release criteria. Full details of in-process testing and lot release testing are available in Supplementary Table 5 and Supplementary Data 3.

Patients were admitted immediately following unmobilized leukapheresis, and received conditioning chemotherapy with busulfan 70,000–80,000 ng/mg*hour (days -5 thru -2) and fludarabine 40 mg/m²/day (days -5 thru -2)²³. On Day 0, patients received the transgenic PBSC infusion (thawed at bedside and then administered with 500 mL normal saline). On day +1, patients received up to 10⁹ of the transgenic TCR lymphocytes as an IV infusion of freshly prepared cells. Patients then received low-dose IL-2 therapy (500,000 IU/m2 subcutaneously) the following morning (day +2) twice daily for up to 14 doses (through day +8), as tolerated. Standard supportive care provided post-infusion included filgrastim, antibiotics for neutropenic fever, twice weekly CMV and EBV serum PCRs, and blood product transfusions as needed. When patients recovered peripheral neutrophil counts and were no longer transfusion-dependent, they were discharged from the hospital. A research [¹⁸F]FHBG positron emission tomography-computed tomography (PET/CT) scan with IV contrast was performed on day +30 as described below, and formal restaging scans (CT or MRI, as clinically indicated) were performed on day +60.

Safety assessments

Adverse events were analyzed following NCI CTCAE v3.0. The known toxicities/side effects of the preparative chemotherapy, IL-2, filgrastim, or plerixafor, as listed in the protocol or package insert, were not considered for the assessment of DLTs. A GALV quantitative PCR (qPCR) assay, developed and optimized at the IU VPF⁵⁰, was used to rule out the presence of replication-competent retrovirus (RCR) and replication-competent lentivirus (RCL). This assay was performed on infusion cell products as well as retrospectively in PBMC processed from post-infusion peripheral blood samples at 3, 6, and 12 months. Annual samples were archived thereafter.

Assessment of feasibility

After entering two patients in each cohort, followed for a minimum of one month after the last subject had received the infusion of the transgenic PBSCs and PBMCs, an assessment of protocol feasibility was performed by the study investigators. Both cell therapies required strict lot release criteria of the final product before administration (as discussed above). Feasibility was based on potential problems in the manufacturing of either cell product or potential problems in the delivery of either cell product in the clinical protocol. If two patients could not receive the intended cellular therapies, further accrual would not be warranted.

Assessment of antitumor activity

Quantification of changes in PET imaging for the intratumoral accumulation of [¹⁸F]FDG within tumor sites and secondary lymphoid organs was performed by counting the total number of FDG avid lesions, as well as the maximum standardized uptake value (SUVmax), normalized to the body weight of the patient at baseline and on day +60. The objective clinical response rate was assessed on day +60 scans and recorded following modified Response Evaluation Criteria in Solid Tumors (RECIST1.1⁵¹).

MHC dextramer immunologic monitoring

Detection of NY-ESO-1 TCR expression using fluorescent MHC dextramer analysis for NY-ESO-1 (Immudex, Copenhagen, Denmark) was performed on cryopreserved peripheral blood mononuclear cells (PBMCs) collected at different time points, as previously described in refs. ^4,52. Our previous definitions for a positive or negative immunologic response using standardized MHC multimer assays were used, which are based on the assay performance specifications by defining changes that were beyond the assay variability with a 95% confidence level⁵². Representative flow cytometry plot is shown in Supplementary Fig. 8.

In vivo imaging of transgenic HSCs via [18 F]-FHBG PET

Patients were injected with 200 MBq [¹⁸F]FHBG approximately 25 days and 120 days after ACT, with allowed variability of ± 10 days and ±30 days, respectively. One-hour post injection, a PET/CT scan was acquired. Scans of the extremities were performed in patients with metastatic lesions in the arms or legs. The CT scans were performed in a “low dose mode” (110 kVp, 30 mAs anode current), resulting in an effective dose of less than 1.3 mSv per scan^53,54. These doses are comparable with typical diagnostic CT or PET scans and below the limits set by federal regulations for research studies involving radioactive imaging agents. The US Food and Drug Administration has previously approved its use as an investigational new drug in clinical trials⁵⁵.

Regional uptake of [¹⁸F]FHBG within metastatic tumor sites and secondary lymphoid organs was quantified by SUV normalized to the body weight of the patient. As an internal quality control, SUVs were also be determined for several normal organs, such as muscle, liver, and lungs. These measurements allowed identification of any technical problems in the SUV calculations, such as partially paravenous tracer administration^56,57. All imaging studies were performed on the same PET/CT system in order to eliminate confounding effects of differences in scanner sensitivity, spatial resolution, or image processing.

Digital droplet PCR to determine retroviral and lentiviral progeny persistence in vivo

DNA from transduced and mock PBMC/T-cells was isolated via the AllPrep DNA/RNA Micro Kit (Qiagen, Hilden, Germany). ddPCR was carried out using the ddPCR Supermix for probes (Biorad 1863023, Hercules, CA), using probes and specific primers to differentiate the lentiviral or retroviral NY-ESO1 TCR sequence. For lentivirus or retrovirus detection, a common forward primer was used LVorRV R: GTCTCTCAGCTGGTACACGGC with either lentiviral specific LV F: TAAGAGCAGCGGCCGGTCC, or retroviral specific RV F: GCTGGATAAATCATCAGGACGTAGT, in combination with genomic calibrator SDC4 gene primers F: CAGGGTCTGGGAGCCAAGT, R: Probe: GCACAGTGCTGGACATTGACA. PCR was run and VCN determined by ddPCR as per manufacturer instructions. FAM conjugates probes were used to detect viruses; Lentiviral probe: ACCAGCCTGATCGTGCACCCCTACA, and retroviral probe: AACCAGCCTTATTGTTCATCCGTAT. SDC4 calibrator probe was conjugated to HEX: CCCACCGAACCCAAGAAACTAGAGGAGAAT.

Antigen stimulation co-culture experiments

For antigen stimulation co-culture experiments, patient NYSCT-03 PBMC samples were thawed and recovered overnight in RPMI 1640 (Thermo A1049101, Waltham, MA) supplemented with heat-inactivated 10% fetal Bovine serum (R10) and IL-2 to a final concentration of 17 ng/mL (BioLegend #589102, San Diego, CA) (R10 + IL2). The next day PBMCs were plated with adherent human melanoma cells M257 (which are positive for NY-ESO-1), or with M257 cells which were transduced to express HLA-A:02:01 (M257-HLA) cell lines⁵⁸ at a 1:1 cell ratio, and co-cultured in R10 + IL2. M257 cells were isolated and generated by Antoni Ribas as previously described⁵⁸. Cells were tested annually for mycoplasma contamination via MyoALERT kit (Lonza, Basel, Switzerland). For ELISA experiments, melanoma cells were seeded at 1 × 10⁵ or 5 × 10⁵ cells per well, and then co-cultured with equal amount of PBMC cells in R10 + IL2 as above. Cells were co-cultured as described above for 20 h, afterwards, plates were centrifuged and supernatant collected. ELISAs were performed by incubating 50 μL of co-culture supernatant with biotinylated IFNγ antibody as described by the manufacturer (Invitrogen EHIFNG, Carlsbad, CA). ELISA plates were washed and incubated with secondary HRP-conjugated streptavidin, and visualized using a TMB substrate and read on a Cellular Technology Limited plate reader (Kennesaw, GA). NYSCT patient PBMC, untransduced PBSCs, and PBSCs transduced with NYESO1TCR/sr39TK LV were recovered overnight in R10 ( IL2 17 ng/mL) at concentration of 1 × 10⁶ cells/mL. Co-cultures were set up in round-bottom 96-well plates, with 1 × 10⁵ cells from each group or media plated in a total of 100 μL of R10 (+Il2), then incubated for 20 h. IFNy ELISA (R&D Systems, cat#DIF50C) was performed per manufacturer instructions as above. Briefly, co-culture supernatant was used in a 1:5 dilution in sandwich ELISA for human IFNy and pg/mL calculated based of standard curve (from 15 to 1000 pg/mL).

Statistical analysis

Graphing and statistical analyses were performed using GraphPad Prism V.9. Comparisons between interferon-gamma release from subject PBMCs and transduced vs untransduced PBSCs, and from NYSCT03 co-cultures with different HLA-A*02:01 positive cells utilized the unpaired t-test with Welch’s correction. p values of <0.05 were considered significant for all analyses.

Single nuclei suspension preparation from PBMCs

Nuclei Isolation for Single Cell Multiome ATAC + Gene Expression Sequencing Protocol from 10x Genomics (CG000365 - Rev C, Pleasanton, CA) was followed for primary cells/fragile cell thawing and nuclei isolation according to manufacturer’s protocol. Briefly, NYSCT-03 patient’s PBMCs from day 43 post-transduction (≈4.6 million cells) were thawed in water at 37 °C for 1–2 min. Cells were then transferred into a 50 mL conical tube, and the cryovial was rinsed with 1 mL pre-warmed media (RPMI + 10% FBS), which was added dropwise to the 50 mL tube while gently shaking at 300 rpm at 37 °C on the thermomixer. Cells were diluted by incremental 1:1 volume additions of media for a total of 5 times every minute then centrifuged at 300 × g for 5 min. The supernatant was carefully removed, leaving ~1 mL to resuspend the pellet in, then 9 mL media was added, followed by centrifugation at 300 × g for 5 min. The supernatant was carefully removed and pellet resuspended in 1 mL PBS + 1% BSA (wash buffer, WB), with gentle pipetting 5x. Cell suspension was transferred and then washed with 0.5 mL WB to a 2 mL microcentrifuge tube. Prior to nuclei isolation, to remove ambient/background DNA, cells were treated with DNase I (Sigma-Aldrich, D5025, St. Louis, MO), which was resuspended in 1xPBS (no Mg+, no Ca2+) to 2.7KU/mL, as an 100x stock, using 100uL into 1 mL, for a cell concentration of 1 × 10⁶/mL. Briefly, cells were centrifuged at 300 × g for 10 min at 4 °C, supernatant was removed, 300 µL DNase Solution was added, mixed 5x, incubated on ice for 5 min, followed by 2 washes by adding 1 mL WB and spun down at 300 × g for 10 min at 4 °C each. Cell concentration was determined by trypan blue cell counting, and cells were then flow sorted for granulocyte removal before nuclei isolation using a 100 µm nozzle (BD FACSMelody, Franklin Lakes, NJ) using 3 µL of 7AAD in every 500 µL of cell suspension, then sorted in a 5-mL FACS tube containing 500 µL WB. Cell concentration and quality were determined by trypan blue cell counting, followed by nuclei isolation as follows. One to two million cells were added to a 2-mL microcentrifuge tube and centrifuged at 300 × g for 5 min at 4 °C. The supernatant was removed and 100 µL chilled Lysis Buffer with RNAse inhibitor (Sigma Protector, 3335402001, St. Louis, MO) was added and pipetted gently 10x, incubated for 3 min on ice, then washed 3 times by adding 1 mL chilled WB for 1.5 min, mixed 5x, centrifuged at 500 × g for 5 min at 4 °C, and the supernatant was gently removed. Nuclei concentration and quality were determined using Countess II FL Automated Cell Counter, and nuclei were resuspended in WB + RNAse inhibitor to a final concentration of 3230–8060 nuclei/µL. We then immediately proceeded to the 10x genomics Chromium Next GEM Single Cell Multiome ATAC + Gene Expression User Guide (CG000338) for library prep according to the manufacturer’s protocol.

10x library preparation and sequencing of single nuclei multiome ATAC + gene expression sequencing

Chromium Next GEM Single Nuclei Multiome ATAC + Gene Expression Library & Gel Bead Kit from 10x Genomics was used according to manufacturer’s protocol (CG000338 Rev F). Briefly, following nuclei isolation, transposition was performed, nuclei were counted using trypan blue, around 20,000 total nuclei were loaded, and nuclei and barcoded beads were isolated in oil droplets on the Chromium Controller instrument. This was followed by post-GEM incubation cleanup, library pre-amplification PCR, cDNA amplification, single cell ATAC library construction, and Gene Expression library construction steps according to manufacturer’s protocol. Barcoded libraries were then sequenced on Illumina using half a lane of Novaseq SP 100 cycles with half a lane of XP for the Gene Expression library and one lane of Novaseq SP 100 cycles with one lane of XP for the ATAC library.

Sequencing read alignments and quality control (QC) of Single Nuclei Multiome ATAC + Gene Expression data

Cell Ranger Arc (v2.0.2) from 10x Genomics (with Count functionality) was used for aligning reads to the human genome reference (GRCh38) with the addition of the lentivirus and retrovirus plasmids. The reference file was downloaded from the 10x Genomics website (https://support.10xgenomics.com/single-cell-gene-expression/software/downloads/latest). The custom sequences were added following 10x Genomics build a custom reference for Cell Ranger Arc (mkref) (https://support.10xgenomics.com/single-cell-multiome-atac-gex/software/pipelines/latest/tutorial/mkref). The parameters used with Count functionality include --localcores = 16 --localmem = 96.

Single nuclei multiome ATAC + gene expression data preprocessing

For the sequenced PBMC nuclei, Seurat v.5.0.1⁵⁹ was used for all analyses. Briefly, we inputted the RNA and ATAC counts from the filtered_feature_bc_matrix.h5 output from Cell Ranger Arc (v2.0.2) from 10x Genomics and added the RNA and ATAC Assay into a Seurat object using “CreateSeuratObject” and ‘CreateChromatinAssay’ functions. A series of quality filters was applied to only include the barcodes that fell into the categories recommended by Seurat: nCount_ATAC < 70000 and nCount_ATAC > 1000, nCount_RNA < 25000 and nCount_RNA > 1000, and to avoid assaying possible dead cell or a sign of cellular stress and apoptosis with too high proportion of mitochondrial gene expression over the total transcript counts, we limited the mitochondrial content percentage (percent.mt) <25. The RNA data was then scaled and normalized using Seurat’s “NormalizeData” with normalization.method = “LogNormalize” and scale.factor = 10000, “FindVariableFeatures” with selection.method = “vst”, and nfeatures = 2000. Data was then scaled using “ScaleData” and top 20 PCA dimensions were assayed via “FindNeighbors” and “FindClusters” (with parameters: resolution = 0.5) functions. The “RunUMAP” function (with default parameters) and the first 20 PCs were used to perform the Uniform Manifold Approximation and Projection (UMAP), a standard dimensional reduction step, to visualize the snRNA data. The filtered peak count for ATAC matrix was normalized using term frequency-inverse document frequency (TF-IDF) normalization implemented in the Signac package using “RunTFIDF” function. This procedure normalizes across nuclei, accounting for differences in coverage and across peaks, giving higher values to rarer peaks. The ‘FindTopFeatures’ function was used to select peaks with features with min.cutoff = “q0” for the dimensional reduction. The “RunSVD” function from Signac package was used to perform singular value decomposition on the normalized TF-IDF matrix using the selected peaks (Latent Semantic Indexing, LSI) dimension reduction. The resulting 2:50 LSI components were used for non-linear dimension reduction using the “RunUMAP” function from the Seurat package with parameter reduction = lsi.

Single nuclei multiome ATAC + gene expression cell-type annotation

The Azimuth Reference for Human PBMC app, a reference-based mapping pipeline led by the New York Genome Center Mapping Component as part of the NIH Human Biomolecular Atlas Project (HuBMAP), was used to generate cell typing for the multiome data⁶⁰. Briefly, the app output was inputted into our Seurat object using Seurat’s “AddMetaData” function to add the predicted cell type annotation as well as the predicted cell type score for both celltype.l1 (shorter list of PBMC cell types only) and celltype.l2 (default – larger list of PBMC cell types and cell states). The prediction scores range from 0 to 1 and reflect the confidence associated with each annotation, where a prediction score > 0.75 reflects predictions supported by multiple consistent anchors. To sharpen the cell typing, we extracted the gene sets that belong to each cell type/state for each cluster from the Azimuth Reference for human PBMC, and manually added the cell type/state into Seurat using “AddModuleScore” function for each celltype.l1 and celltype.l2. We then annotated the cell type/state per nuclei based on the most enriched score across each nucleus, which resulted in a much more defined and better clustering technique.

The gene sets used for celltype.l1 and celltype.l2 (filtered for the most ubiquitously expressed genes across all nuclei to avoid over-calling) from the Azimuth Reference for human PBMC are summarized in Supplementary Data 5 and Supplementary Data 6, respectively. The genes that were used to plot the heat maps in Supplementary Fig. 7 are “RNF128”, “EGR2”, “EGR3”, “NFATC1”, “BATF”, “PDCD1”, “CTLA4”, “LAG3”, “HAVCR2”, “TIGIT”, “CBLB”, “ITCH”, “DGKA”, “PTEN”, “PRKAA1”, “NT5E”, “ENTPD1”, “CD244”, “IL10”, “TGFB1”, “SOCS1”, “SOCS3” for anergy and “PDCD1”, “CTLA4”, “LAG3”, “HAVCR2”, “TIGIT”, “ENTPD1”, “TOX”, “TOX2”, “BATF”, “EOMES”, “TBX21”, “IRF4”, “PRDM1”, “NFATC1”, “NFATC2”, “ZEB2”, “GZMB”, “GZMK”, “GZMH”, “PRF1”, “CXCL13”, “CXCR5” for exhaustion markers.

Generation of coverage profiles from snATACseq and snRNAseq

Fragments from snATACseq were aligned against reference genome and filtered against barcode while lists were based on cell type of interest (e.g., Tcell+ cells). Raw fragment reads were converted into reads-per-kilobase/library-size (i.e., RPKM-like, we term this RPKB, as the final 1e6 scaling is omitted to prevent float overflow during computation). To generate coverage of the fragments across an area of interest (Supplementary Fig. 9A), we subsetted reads for those between set start and end sites of a given chromosome. RPKB values were then averaged across 10 bp bins in a sliding window fashion of 1 bp step sizes (no padding was done to ensure all data used was real). For snRNAseq, position-sorted BAM files were converted into bigwig-type files via deepTools. These bigwig files were then read in to repeat the same type calculations as done for snATAC-seq, with read coverages also aggregated at a resolution of 10 bp and normalized via RPKM (Supplementary Fig. 9B). The map of the lentiviral Vector pRRL-MSCV-optNYESO optsr39TK-WPRE-1 used in the manufacturing of PBSC cell products is shown, which was used to alight the reads to in both A and B (Supplementary Fig. 9C).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Raw sequencing data are available via dbGaP (accession number phs003898.v1; https://www.ncbi.nlm.nih.gov/gap/advanced_search/?TERM=phs003898.v1). Source data for other figures are provided as a Source Data file. All other data (PET/CT images) are available upon request from the corresponding author only due to patient confidentiality laws. Source data are provided with this paper.

References

Robbins, P. F. et al. Tumor regression in patients with metastatic synovial cell sarcoma and melanoma using genetically engineered lymphocytes reactive with NY-ESO-1. J. Clin. Oncol. 29, 917–924 (2011).
Article PubMed PubMed Central Google Scholar
Robbins, P. F. et al. A pilot trial using lymphocytes genetically engineered with an NY-ESO-1-reactive T-cell receptor: long-term follow-up and correlates with response. Clin. Cancer Res.21, 1019–1027 (2015).
Article CAS PubMed Google Scholar
Nowicki, T. S. et al. A pilot trial of the combination of transgenic NY-ESO-1-reactive adoptive cellular therapy with dendritic cell vaccination with or without ipilimumab. Clin. Cancer Res. 25, 2096–2108 (2019).
Article CAS PubMed Google Scholar
Chodon, T. et al. Adoptive transfer of MART-1 T-cell receptor transgenic lymphocytes and dendritic cell vaccination in patients with metastatic melanoma. Clin. Cancer Res. 20, 2457–2465 (2014).
Article CAS PubMed PubMed Central Google Scholar
Nagarsheth, N. B. et al. TCR-engineered T cells targeting E7 for patients with metastatic HPV-associated epithelial cancers. Nat. Med. 27, 419–425 (2021).
Article CAS PubMed PubMed Central Google Scholar
Rapoport, A. P. et al. NY-ESO-1-specific TCR-engineered T cells mediate sustained antigen-specific antitumor effects in myeloma. Nat. Med. 21, 914–921 (2015).
Article CAS PubMed PubMed Central Google Scholar
D’Angelo, S. P. et al. Antitumor activity associated with prolonged persistence of adoptively transferred NY-ESO-1 (c259)T cells in synovial sarcoma. Cancer Discov. 8, 944–957 (2018).
Article PubMed PubMed Central Google Scholar
Nowicki, T. S. et al. Characterization of postinfusion phenotypic differences in fresh versus cryopreserved TCR engineered adoptive cell therapy products. J. Immunother. 41, 248–259 (2018).
Article CAS PubMed PubMed Central Google Scholar
Vatakis, D. N. et al. Antitumor activity from antigen-specific CD8 T cells generated in vivo from genetically engineered human hematopoietic stem cells. Proc. Natl. Acad. Sci. USA 108, E1408–E1416 (2011).
Article CAS PubMed PubMed Central Google Scholar
Yang, L. & Baltimore, D. Long-term in vivo provision of antigen-specific T cell immunity by programming hematopoietic stem cells. Proc. Natl. Acad. Sci. USA 102, 4518–4523 (2005).
Article CAS PubMed PubMed Central Google Scholar
Yang, L., Qin, X. F., Baltimore, D. & Van Parijs, L. Generation of functional antigen-specific T cells in defined genetic backgrounds by retrovirus-mediated expression of TCR cDNAs in hematopoietic precursor cells. Proc. Natl. Acad. Sci. USA 99, 6204–6209 (2002).
Article CAS PubMed PubMed Central Google Scholar
Puig-Saus, C. et al. IND-enabling studies for a clinical trial to genetically program a persistent cancer-targeted immune system. Clin Cancer Res. https://doi.org/10.1158/1078-0432.CCR-18-0963 (2018).
Gschweng, E. H. et al. HSV-sr39TK positron emission tomography and suicide gene elimination of human hematopoietic stem cells and their progeny in humanized mice. Cancer Res. 74, 5173–5183 (2014).
Article CAS PubMed PubMed Central Google Scholar
Puig-Saus, C. et al. Ind-enabling studies for a clinical trial to genetically program a persistent cancer-targeted immune system. Clin. Cancer Res. 25, 1000–1011 (2019).
Article CAS PubMed Google Scholar
Yaghoubi, S. S. et al. Imaging progress of herpes simplex virus type 1 thymidine kinase suicide gene therapy in living subjects with positron emission tomography. Cancer Gene Ther. 12, 329–339 (2005).
Article CAS PubMed Google Scholar
Dubey, P. et al. Quantitative imaging of the T cell antitumor response by positron-emission tomography. Proc. Natl. Acad. Sci. USA 100, 1232–1237 (2003).
Article CAS PubMed PubMed Central Google Scholar
Kim, Y. J., Dubey, P., Ray, P., Gambhir, S. S. & Witte, O. N. Multimodality imaging of lymphocytic migration using lentiviral-based transduction of a tri-fusion reporter gene. Mol. Imaging Biol. 6, 331–340 (2004).
Article PubMed Google Scholar
Lee, C. C. et al. Multistep synthesis of a radiolabeled imaging probe using integrated microfluidics. Science310, 1793–1796 (2005).
Article CAS PubMed Google Scholar
Shu, C. J. et al. Visualization of a primary anti-tumor immune response by positron emission tomography. Proc. Natl. Acad. Sci. USA 102, 17412–17417 (2005).
Article CAS PubMed PubMed Central Google Scholar
Radu, C. G., Shu, C. J., Shelly, S. M., Phelps, M. E. & Witte, O. N. Positron emission tomography with computed tomography imaging of neuroinflammation in experimental autoimmune encephalomyelitis. Proc. Natl. Acad. Sci. USA 104, 1937–1942 (2007).
Article CAS PubMed PubMed Central Google Scholar
Prins, R. M. et al. Anti-tumor activity and trafficking of self, tumor-specific T cells against tumors located in the brain. Cancer Immunol. Immunotherapy CII 57, 1279–1289 (2008).
Article CAS PubMed Google Scholar
Shu, C. J. et al. Quantitative PET reporter gene imaging of CD8+ T cells specific for a melanoma-expressed self-antigen. Int. Immunol. 21, 155–165 (2009).
Article CAS PubMed Google Scholar
de Lima, M. et al. Once-daily intravenous busulfan and fludarabine: clinical and pharmacokinetic results of a myeloablative, reduced-toxicity conditioning regimen for allogeneic stem cell transplantation in AML and MDS. Blood 104, 857–864 (2004).
Article PubMed Google Scholar
Yaghoubi, S. S. & Gambhir, S. S. PET imaging of herpes simplex virus type 1 thymidine kinase (HSV1-tk) or mutant HSV1-sr39tk reporter gene expression in mice and humans using [18F]FHBG. Nat. Protoc. 1, 3069–3075 (2006).
Article CAS PubMed Google Scholar
Giannoni, F. et al. Allelic exclusion and peripheral reconstitution by TCR transgenic T cells arising from transduced human hematopoietic stem/progenitor cells. Mol. Ther. 21, 1044–1054 (2013).
Article CAS PubMed PubMed Central Google Scholar
D’Angelo, S. P. et al. Afamitresgene autoleucel for advanced synovial sarcoma and myxoid round cell liposarcoma (SPEARHEAD-1): an international, open-label, phase 2 trial. Lancet 403, 1460–1471 (2024).
Article PubMed PubMed Central Google Scholar
Ma, C. et al. Multifunctional T-cell analyses to study response and progression in adoptive cell transfer immunotherapy. Cancer Discov. 3, 418–429 (2013).
Article CAS PubMed PubMed Central Google Scholar
Kohn, D. B. et al. Lentiviral gene therapy for X-linked chronic granulomatous disease. Nat. Med. 26, 200–206 (2020).
Article CAS PubMed PubMed Central Google Scholar
Kohn, D. B. et al. Autologous Ex vivo lentiviral gene therapy for adenosine deaminase deficiency. N. Engl. J. Med. 384, 2002–2013 (2021).
Article CAS PubMed PubMed Central Google Scholar
Modlich, U. et al. Cell-culture assays reveal the importance of retroviral vector design for insertional genotoxicity. Blood 108, 2545–2553 (2006).
Article CAS PubMed PubMed Central Google Scholar
Modlich, U. et al. Leukemia induction after a single retroviral vector insertion in Evi1 or Prdm16. Leukemia 22, 1519–1528 (2008).
Article CAS PubMed Google Scholar
Montini, E. et al. Hematopoietic stem cell gene transfer in a tumor-prone mouse model uncovers low genotoxicity of lentiviral vector integration. Nat. Biotechnol. 24, 687–696 (2006).
Article CAS PubMed Google Scholar
Zychlinski, D. et al. Physiological promoters reduce the genotoxic risk of integrating gene vectors. Mol. Ther. 16, 718–725 (2008).
Article CAS PubMed Google Scholar
Baum, C., Kustikova, O., Modlich, U., Li, Z. & Fehse, B. Mutagenesis and oncogenesis by chromosomal insertion of gene transfer vectors. Hum. Gene Ther. 17, 253–263 (2006).
Article CAS PubMed Google Scholar
Swindle, C. S., Kim, H. G. & Klug, C. A. Mutation of CpGs in the murine stem cell virus retroviral vector long terminal repeat represses silencing in embryonic stem cells. J. Biol. Chem. 279, 34–41 (2004).
Article CAS PubMed Google Scholar
Nowicki, T. S. et al. Epigenetic suppression of transgenic T-cell receptor expression via gamma-retroviral vector methylation in adoptive cell transfer therapy. Cancer Discov. 10, 1645–1653 (2020).
Article CAS PubMed PubMed Central Google Scholar
Papapetrou, E. P., Kovalovsky, D., Beloeil, L., Sant’angelo, D. & Sadelain, M. Harnessing endogenous miR-181a to segregate transgenic antigen receptor expression in developing versus post-thymic T cells in murine hematopoietic chimeras. J. Clin. Investig. 119, 157–168 (2009).
CAS PubMed Google Scholar
Frankiw, L. et al. Immunotherapy resistance driven by loss of NY-ESO-1 expression in response to transgenic adoptive cellular therapy with PD-1 blockade. J Immunother Cancer 11, https://doi.org/10.1136/jitc-2023-006930 (2023).
Drabko, K. et al. Consolidation of first-line therapy with busulphan and melphalan, and autologous stem cell rescue in children with Ewing’s sarcoma. Bone Marrow Transpl. 47, 1530–1534 (2012).
Article CAS Google Scholar
Bailey, K., Roth, M., Weiser, D. & Gill, J. High-dose chemotherapy with stem cell rescue in desmoplastic small round cell tumor: a single-institution experience and review of the literature. Sarcoma 2018, 1948093 (2018).
Article PubMed PubMed Central Google Scholar
Berger, C., Flowers, M. E., Warren, E. H. & Riddell, S. R. Analysis of transgene-specific immune responses that limit the in vivo persistence of adoptively transferred HSV-TK-modified donor T cells after allogeneic hematopoietic cell transplantation. Blood 107, 2294–2302 (2006).
Article CAS PubMed PubMed Central Google Scholar
Riddell, S. R. et al. T-cell mediated rejection of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-infected patients. Nat. Med. 2, 216–223 (1996).
Article CAS PubMed Google Scholar
Kitchen, S. G. et al. Engineering antigen-specific T cells from genetically modified human hematopoietic stem cells in immunodeficient mice. PLoS ONE 4, e8208 (2009).
Article PubMed PubMed Central Google Scholar
Kitchen, S. G. et al. In vivo suppression of HIV by antigen specific T cells derived from engineered hematopoietic stem cells. PLoS Pathog. 8, e1002649 (2012).
Article CAS PubMed PubMed Central Google Scholar
Zhen, A. et al. HIV-specific Immunity derived from chimeric antigen receptor-engineered stem cells. Mol. Ther. 23, 1358–1367 (2015).
Article CAS PubMed PubMed Central Google Scholar
Zhu, Y. et al. Development of hematopoietic stem cell-engineered invariant natural killer T cell therapy for cancer. Cell Stem Cell 25, 542–557 e549 (2019).
Article CAS PubMed PubMed Central Google Scholar
De Oliveira, S. N. et al. Modification of hematopoietic stem/progenitor cells with CD19-specific chimeric antigen receptors as a novel approach for cancer immunotherapy. Hum. Gene Ther. 24, 824–839 (2013).
Article PubMed PubMed Central Google Scholar
Larson, S. M. et al. Pre-clinical development of gene modification of haematopoietic stem cells with chimeric antigen receptors for cancer immunotherapy. Hum. Vaccin Immunother. 13, 1094–1104 (2017).
Article PubMed PubMed Central Google Scholar
Figlin, R. et al. Interleukin-2-based immunotherapy for the treatment of metastatic renal cell carcinoma: an analysis of 203 consecutively treated patients. Cancer J. Sci. Am. 3, S92–S97 (1997).
PubMed Google Scholar
Sastry, L. & Cornetta, K. Detection of replication competent retrovirus and lentivirus. Methods Mol. Biol. 506, 243–263 (2009).
Article CAS PubMed Google Scholar
Eisenhauer, E. A. et al. New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur. J. Cancer 45, 228–247 (2009).
Article CAS PubMed Google Scholar
Comin-Anduix, B. et al. Definition of an immunologic response using the major histocompatibility complex tetramer and enzyme-linked immunospot assays. Clin. Cancer Res. 12, 107–116 (2006).
Article CAS PubMed Google Scholar
Brix, G. et al. Radiation exposure of patients undergoing whole-body dual-modality 18F-FDG PET/CT examinations. J. Nucl. Med.46, 608–613 (2005).
CAS PubMed Google Scholar
Yaghoubi, S. et al. Human pharmacokinetic and dosimetry studies of [(18)F]FHBG: a reporter probe for imaging herpes simplex virus type-1 thymidine kinase reporter gene expression. J. Nucl. Med.42, 1225–1234 (2001).
CAS PubMed Google Scholar
Yaghoubi, S. S. & Gambhir, S. S. Measuring herpes simplex virus thymidine kinase reporter gene expression in vitro. Nat. Protoc. 1, 2137–2142 (2006).
Article CAS PubMed Google Scholar
Czernin, J., Weber, W. A. & Herschman, H. R. Molecular imaging in the development of cancer therapeutics. Annu Rev. Med. 57, 99–118 (2006).
Article CAS PubMed Google Scholar
Weber, W. A. Use of PET for monitoring cancer therapy and for predicting outcome. J. Nucl. Med.46, 983–995 (2005).
CAS PubMed Google Scholar
Sondergaard, J. N. et al. Differential sensitivity of melanoma cell lines with BRAFV600E mutation to the specific Raf inhibitor PLX4032. J. Transl. Med. 8, 39 (2010).
Article PubMed PubMed Central Google Scholar
Hao, Y. et al. Dictionary learning for integrative, multimodal and scalable single-cell analysis. Nat. Biotechnol. 42, 293–304 (2024).
Article CAS PubMed Google Scholar
Hao, Y. et al. Integrated analysis of multimodal single-cell data. Cell 184, 3573–3587 e3529 (2021).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

This study was funded by the California Institute for Regenerative Medicine (CIRM) grant CLIN2-11380. T.S.N. was further supported by NIH grant K08 CA241088, Hyundai Hope on Wheels, the Tower Cancer Research Foundation. This study was additionally funded in part by the Parker Institute for Cancer Immunotherapy (PICI), NIH grant R35 CA197633 and the Ressler Family Fund (to A.R.). N.N.A. is supported by the Alan Ghitis Fellowship for Melanoma Research. N.F. is supported by the National Center for Advancing Translational Science (NCATS) of the National Institutes of Health under the UCLA Clinical and Translational Science Institute grant number UL1TR001881 and California Institute for Regenerative Medicine (CIRM) INFR4 Alpha Clinic Network Expansion Award. D.B.K. is supported by endowment funds from the UCLA Eli and Edyth Broad Stem Cell Research Center. The authors gratefully acknowledge the NHLBI National Gene Vector Biorepository at Indiana University (PI Cornetta, P40HL116212) for assistance in the generation and maintenance of the NY-ESO-1 TCR retrovirus and NY-ESO-1 TCR/sr39TK lentivirus vectors. Flow cytometry was performed in the UCLA Jonsson Comprehensive Cancer Center (JCCC) and Center for AIDS Research Flow Cytometry Core Facility that is supported by National Institutes of Health awards P30 CA016042 and 5P30 AI028697, and by the JCCC, the UCLA AIDS Institute, the UCLA Technology Center for Genomics and Bioinformatics (TCGB) core lab, and the David Geffen School of Medicine at UCLA. The authors wish to acknowledge the participation of patients and their caregivers, and the patient care at the Hematology-Oncology Stem Cell Transplantation Unit at UCLA.

Author information

Authors and Affiliations

Division of Pediatric Hematology-Oncology, Department of Pediatrics, University of California Los Angeles, Los Angeles, CA, USA
Theodore S. Nowicki, Cole W. Peters, Moe Kawakami, Conner K. Kidd, Noah Federman & Donald B. Kohn
Department of Microbiology, Immunology, and Molecular Genetics, University of California Los Angeles, Los Angeles, CA, USA
Theodore S. Nowicki, Cristina Puig-Saus, Jerome Zack, Lili Yang, Donald B. Kohn & Owen N. Witte
Jonsson Comprehensive Cancer Center, University of California Los Angeles, Los Angeles, CA, USA
Theodore S. Nowicki, Begoña Comin-Anduix, Cristina Puig-Saus, Salem Haile, Bartosz Chmielowski, Noah Federman, Gary M. Schiller, Sarah J. Larson, Lili Yang, Owen N. Witte & Antoni Ribas
Eli and Edythe Broad Center for Regenerative Medicine and Stem Cell Research, University of California Los Angeles, Los Angeles, CA, USA
Theodore S. Nowicki, Cristina Puig-Saus, Noah Federman, Lili Yang, Owen N. Witte & Antoni Ribas
Molecular Biology Institute, University of California Los Angeles, Los Angeles, CA, USA
Theodore S. Nowicki, Lili Yang & Owen N. Witte
David Geffen School of Medicine, University of California Los Angeles, Los Angeles, CA, USA
Theodore S. Nowicki, Salem Haile, Jonathan Rodriguez, Noah Federman, Martin Allen-Auerbach, Owen N. Witte & Antoni Ribas
Division of Hematology-Oncology, Department of Medicine, University of California Los Angeles, Los Angeles, CA, USA
Nataly Naser Al Deen, Egmidio Medina, Ignacio Baselga Carretero, Paula Kaplan-Lefko, Mignonette H. Macabali, Ivan Perez Garcilazo, Daniel Chen, Jia Pang, Beata Berent-Maoz, Salem Haile, Ameya Champhekar, Agustin Vega-Crespo, Bartosz Chmielowski, Arun Singh, Gary M. Schiller, Sarah J. Larson, Jerome Zack & Antoni Ribas
Ahmanson Translational Theranostics Division, Department of Molecular and Medical Pharmacology, University of California Los Angeles, Los Angeles, CA, USA
Begoña Comin-Anduix & Martin Allen-Auerbach
Division of Surgical Oncology, Department of Surgery, University of California Los Angeles, Los Angeles, CA, USA
Begoña Comin-Anduix, Cristina Puig-Saus & Antoni Ribas
Parker Institute for Cancer Immunotherapy, UCLA, Los Angeles, CA, USA
Cristina Puig-Saus, Owen N. Witte & Antoni Ribas
Department of Molecular and Medical Pharmacology, University of California Los Angeles, Los Angeles, CA, USA
Giuseppe Carlucci & Antoni Ribas
Department of Orthopaedic Surgery, University of California Los Angeles, Los Angeles, CA, USA
Noah Federman
Department of Medicine Statistics Core, David Geffen School of Medicine, University of California Los Angeles, Los Angeles, CA, USA
Alexandra M. Klomhaus
Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA, USA
David Baltimore

Authors

Theodore S. Nowicki
View author publications
Search author on:PubMed Google Scholar
Nataly Naser Al Deen
View author publications
Search author on:PubMed Google Scholar
Cole W. Peters
View author publications
Search author on:PubMed Google Scholar
Begoña Comin-Anduix
View author publications
Search author on:PubMed Google Scholar
Egmidio Medina
View author publications
Search author on:PubMed Google Scholar
Cristina Puig-Saus
View author publications
Search author on:PubMed Google Scholar
Ignacio Baselga Carretero
View author publications
Search author on:PubMed Google Scholar
Paula Kaplan-Lefko
View author publications
Search author on:PubMed Google Scholar
Mignonette H. Macabali
View author publications
Search author on:PubMed Google Scholar
Ivan Perez Garcilazo
View author publications
Search author on:PubMed Google Scholar
Daniel Chen
View author publications
Search author on:PubMed Google Scholar
Jia Pang
View author publications
Search author on:PubMed Google Scholar
Beata Berent-Maoz
View author publications
Search author on:PubMed Google Scholar
Salem Haile
View author publications
Search author on:PubMed Google Scholar
Jonathan Rodriguez
View author publications
Search author on:PubMed Google Scholar
Moe Kawakami
View author publications
Search author on:PubMed Google Scholar
Conner K. Kidd
View author publications
Search author on:PubMed Google Scholar
Ameya Champhekar
View author publications
Search author on:PubMed Google Scholar
Giuseppe Carlucci
View author publications
Search author on:PubMed Google Scholar
Agustin Vega-Crespo
View author publications
Search author on:PubMed Google Scholar
Bartosz Chmielowski
View author publications
Search author on:PubMed Google Scholar
Arun Singh
View author publications
Search author on:PubMed Google Scholar
Noah Federman
View author publications
Search author on:PubMed Google Scholar
Gary M. Schiller
View author publications
Search author on:PubMed Google Scholar
Sarah J. Larson
View author publications
Search author on:PubMed Google Scholar
Martin Allen-Auerbach
View author publications
Search author on:PubMed Google Scholar
Alexandra M. Klomhaus
View author publications
Search author on:PubMed Google Scholar
Jerome Zack
View author publications
Search author on:PubMed Google Scholar
David Baltimore
View author publications
Search author on:PubMed Google Scholar
Lili Yang
View author publications
Search author on:PubMed Google Scholar
Donald B. Kohn
View author publications
Search author on:PubMed Google Scholar
Owen N. Witte
View author publications
Search author on:PubMed Google Scholar
Antoni Ribas
View author publications
Search author on:PubMed Google Scholar

Contributions

T.S.N. and A.R. served as principal investigators for the clinical trial and its design/execution. C.P-S., J.Z., D.B., L.Y., D.B.K., O.N.W., and A.R. conceived and developed the lentiviral vector and its implementation within the clinical protocol. T.S.N., N.N.A., C.W.P., and A.R. wrote the manuscript. I.B.C. and P.K-L. supervised clinical trial regulatory and compliance regulations. B.C-A, M.M., C.W.P., B.B-M., I.P.G., J.P., J.R., A.C., and A.V-C. conducted transgenic cell product manufacturing. T.S.N., A.S., B.C., N.F., G.M.S., S.J.L., and A.R. screened, enrolled, treated, and/or cared for patients on the clinical study protocol. B.C-A. and S.H. conducted flow cytometry analysis. N.N.A., C.W.P., M.K., and C.K. performed single-cell sequencing assays. N.N.A., E.M., and D.C. conducted the bioinformatics analysis. G.C. and M.A-A. designed, conducted, and interpreted the [18 F]-FHBG PET scans. C.W.P., M.K., and C.K. performed the antigen-dependent stimulation assays and ELISAs. A.M.K. assisted with statistical analysis and test design. All authors reviewed and edited the manuscript.

Corresponding author

Correspondence to Theodore S. Nowicki.

Ethics declarations

Competing interests

TSN reports consulting honoraria from Allogene Therapeutics, PACT Pharma, Adaptive Biotechnologies, and Medidata Solutions. NF has received honoraria for speaker’s bureaus and advisory boards from Bayer AG, Fennec Pharmaceuticals, and Springworks Therapeutics, and holds stock ownership in Moderna, Bolt Biotherapeutics, Regulus, Bluebird Bio, and 2seventy Bio. BC has received honoraria for consulting and advisory boards from Novartis, Delcath Systems, Instil Bio, Replimune, Atreca, Regeneron, Treeline Biosciences, and SpringWorks Therapeutics, and has received research funding from Bristol-Myers Squibb, Macrogenics, Karyopharm Therapeutics, Infinity Pharmaceuticals, Advenchen Laboratories, Xencor, Compugen, Iovance Biotherapeutics, RAPT Therapeutics, IDEAYA Biosciences, Ascentage Pharma, Atreca. Replimune, Instil Bio, Adagene, TriSalus Life Sciences, Kinnate Biopharma, PTC Therapeutics, Xilio Therapeutics, Kezar Life Sciences, Immunocore, AskGene Pharma. O.N.W. currently has consulting, equity, and/or board relationships with Trethera Corporation, Kronos Biosciences, Sofie Biosciences, Breakthrough Properties, Vida Ventures, Nammi Therapeutics, Two River, Iconovir, Appia BioSciences, Neogene Therapeutics, 76Bio, and Allogene Therapeutics. A.R. has received honoraria from consulting with Amgen and Roche-Genentech, is or has been a member of the scientific advisory board, and holds stock in Appia, Apricity, Arcus, Compugen, CytomX, ImaginAb, ImmPact, Inspirna, Kite-Gilead, Larkspur, Lutris, MapKure, Merus, Synthekine, and Tango, has received research funding from Agilent and from Bristol-Myers Squibb through Stand Up to Cancer (SU2C), and patent royalties from Arsenal Bio. None of these companies contributed to or directed any of the research reported in this article. D.B. and L.Y. are inventors on patents related to this study filed by California Institute of Technology. All other authors have no competing interests to declare.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data 1

Supplementary Data 2

Supplementary Data 3

Supplementary Data 4

Supplementary Data 5

Supplementary Data 6

Reporting Summary

Transparent Peer Review file

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Nowicki, T.S., Deen, N.N.A., Peters, C.W. et al. Human cancer-targeted immunity via transgenic hematopoietic stem cell progeny. Nat Commun 16, 5599 (2025). https://doi.org/10.1038/s41467-025-60816-z

Download citation

Received: 27 September 2024
Accepted: 29 May 2025
Published: 01 July 2025
DOI: https://doi.org/10.1038/s41467-025-60816-z