Introduction

Asthma is a common chronic inflammatory airway disease. The airway epithelium plays a pivotal role to control asthma pathogenesis. Airway inflammation is initiated while exposing airway epithelium to aeroallergens, microbes, or environmental stimuli, followed by amplification of dysregulated immune cells through inflammatory cascades, and finally, as a result of airway remodeling1. Airway remodeling links to poor clinical outcomes, such as fixed-airway obstruction, accelerated decline in lung function, uncontrolled symptoms, and frequent exacerbations2,3. Airway remodeling is more prevalent in moderate to severe asthma but is also evident in mild asthma and observed as early as in preschool children with asthma symptoms2,3. Remodeling, the consequence of airway structural changes, is characterized by epithelial cell damage, smooth muscle cell proliferation, fibroblast activation, and increased deposition of extracellular matrix (ECM) proteins1,2,3. Among these remodeling effectors, fibroblasts (the major producer of ECM) and collagen (the most abundant elements of ECM) usually serve as markers of airway remodeling in experimental studies. The mechanism of epithelium-fibroblast interactions in airway remodeling is complicated and has become a research interest.

Allergic asthma, the most common type of asthma, has affected around 50–60% of children and adults with asthma4. Overreaction of the immune system in response to chronic inhalation of aeroallergens is the major pathogenesis of allergic asthma. House dust mites (HDM), such as Dermatophagoides pteronyssinus, are one of the most pervasive aeroallergens and strong inducers of allergenicity, which conduces to atopic sensitization in 50–85% of asthmatics5. HDM exerts several proteases with proteolytic activity, contributing to damage of epithelial barrier, subepithelial invasion of antigens, activation of dendritic cells, and differentiation of T helper 2 (Th2) cells, which modulates downstream allergic inflammatory cascade and is recognized as Th2 high asthma5,6,7,8. Additionally, HDM can directly stimulate airway epithelium to produce epithelium-derived cytokines (also known as alarmins), including thymic stromal lymphopoietin (TSLP), IL-25, and IL-33, which can induce both innate and adaptive immune responses and propel Th2 immunity8,9,10. HDM aeroallergens represent a great burden on asthma from early sensitization to late disease progression8. Therefore, understanding the linkage from HDM-alarmins (e.g., TSLP) formation to epithelium-fibroblast paracrine signaling pathways toward remodeling pathogenesis becomes a crucial issue in blocking the remodeling process.

Protease-activated receptors (PARs), a family of seven transmembrane, G protein-coupled receptors, have 4 members (PAR1-4). All subtypes are expressed in human airway epithelium and act as targets for signaling in response to various proteolytic triggers. Particularly, PAR2-mediated activation on airway epithelium has been reported to release many mediators, such as IL-6, IL-8, IL-25, granulocyte-macrophage colony-stimulating factor (GM-CSF), eotaxin, and matrix metalloprotease to modulate the immune response toward Th2 phenotype and remodeling11,12. An animal study also showed that PAR2 blockade with an anti-PAR2 antibody could inhibit airway inflammation and remolding in mice stimulated with inhaled cockroach extract for 12 weeks13. Additionally, PAR2 expression on airway epithelium was increased in patients with asthma14. These findings suggest that PAR2 on the airway epithelium plays a pathological role and might be a therapeutic target in asthma.

TSLP is increased in response to external stimuli (e.g., aeroallergens) and endogenous proinflammatory mediators (e.g., Th2 cytokines), indicating positive feedback for Th2 response10. TSLP promotes allergic response and airway modeling by modulating downstream effector cells (e.g., dendritic cells, Th2 cells, and type 2 innate lymphoid cells [ILC2s]) and inducing airway structural changes (e.g., smooth muscle hypertrophy and epithelial-mesenchymal transition)3,10,15. In asthma patients, TSLP expressions were increased on airway epithelium16,17 and bronchoalveolar lavage fluid18, and were associated with asthma severity16,17,18. Recently, we also reported blood TSLP levels can predict the risk of exacerbation in patients with severe asthma19. Anti-TSLP neutralization antibody, emerging as a promising treatment in patients with severe asthma, is proven to improve asthma control outcomes effectively and potentially reverse airway remodeling3,20. Thus, the mechanism of TSLP-related airway remodeling deserves further elucidation.

Therefore, we hypothesized that HDM can induce TSLP production on the airway epithelium through PAR2 activation and downstream signaling pathways, contributing to airway remodeling.

Materials and methods

Drugs, reagents, and antibodies

The drugs and reagents used in this study are listed in the following: HDM (extract of D. pteronyssinus whole culture, containing both serine and cysteine protease activity, Citeq Biologics, Groningen, Netherlands), PAR2 antagonist (FSLLRY-NH2 [FSL], Tocris Bioscience, Bristol, UK), extracellular signal-regulated kinase1/2 (ERK) inhibitor (PD98059), dexamethasone (both from Sigma-Aldrich, St. Louis, MO, USA), recombinant human TSLP protein and anti-human TSLP neutralization antibody (both from R&D system, Minneapolis, MN, USA). Antibodies against ERK, phospho-ERK, p38, phospho-p38, Jun N-terminal kinase (JNK), phospho-JNK, and β-actin were obtained from Cell Signaling Technology (Danvers, MA, USA). This study was approved by the Institutional Review Board of Taipei Veterans General Hospital (ID 2019-08-004B). Informed consents were obtained from patients before surgical lobectomy of the lung. All procedures performed in this study involving human participants were in accordance with the Declaration of Helsinki.

Human bronchial epithelial cells

Normal HBECs were purchased from ScienCell (ScienCell Research Laboratories, San Diego, California). HBECs were cultured in a serum-free bronchial epithelial cell medium (ScienCell Research Laboratories) containing essential and non-essential amino acids, vitamins, hormones, growth factors, and trace minerals. HBECs were grown in the poly-L-lysine-coated culture plates (2 µg/cm2, ScienCell Research Laboratories). HBECs were seeded onto 6-well culture plates (1 cc, cell density 5 × 105 cells/cm2) for western blots or onto 24-well culture plates (0.5 cc, cell density 1 × 105 cells/cm2) to collect supernatants for conditioned medium (CM) and measurement of TSLP. HBECs were incubated for 3 to 5 days until a confluent monolayer was formed and used for experiments.

Human lung fibroblasts

Human lung fibroblasts (HLFs) were obtained from surgical lobectomy for lung cancer as described previously21. Human lung parenchyma of the resected lung was rinsed several times with Leibovitz’s L-15 medium containing penicillin (100 U/mL), streptomycin (100 mg/mL), and amphotericin B (0.25 mg/mL). The tissue was cut into 1- to 2-mm2 pieces, and 3 to 4 pieces of tissue were planted onto 6-well culture plates. The fibroblast culture medium consisted of antibiotics/antimycotics, glutamine (2 mM), and 10% FBS in DMEM. After 2 weeks of incubation, the confluent HLFs were detached from the plates by trypsinization. Subsequently, an aliquot of HLFs (0.5 cc, cell density 1 × 105 cells/cm2) was seeded onto 24-well culture plates and grown for 4 to 5 days till confluence for experiments.

Treatment of human bronchial epithelial cells

Confluent monolayer of HBECs in 24-well culture wells were stimulated with HDM at different concentrations (50, 100, and 200 µM). After incubation for indicated periods (3 h, 6 h, and 24 h), the supernatants were collected and frozen at -80℃ until measurements of TSLP. TSLP concentrations were calculated using a human TSLP Quantikine ELISA Kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. Therefore, HDM 200 µM and 6 h were regarded as the optimal conditions for further experiments. Subsequently, HBECs were treated with HDM 200 µM in the absence or presence of 2-h preincubation of dexamethasone (100 µM), various concentrations of FSL (25, 50, and 100 µM), and PD98059 (10 µM) for 6 h. At the end of the experiments, supernatants were collected to measure TSLP. The optimal concentration of FSL was determined as 100 µM and was applied in the following experiments. Cell viability was determined by light microscopy and dye exclusion with trypan blue.

Real-time quantitative PCR for TSLP mRNA

The response of HDM-related production of TSLP at mRNA levels was determined by quantitative PCR. HBECs were treated with HDM 200 µM for 3 h. At the end of treatment, total RNA of the HBECs was isolated by the Trizol reagent (Invitrogen) and was used for cDNA synthesis performing reverse transcriptase (Promega Corporation, Madison, WI, USA) with oligo-dT as the primer. The obtained cDNAs were then used as templates for semi-quantitative PCR. PCR was performed in a real-time PCR system (LightCycler® 480 System, Roche Diagnostics, Mannheim, Germany). The PCR program was 95°C for 2 min; 45 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 15s; and one cycle of 72°C for 10 min. The levels of TSLP mRNA in each sample were calculated based on the relative standard curve generated with the RNA from HBECs. The data were normalized to the expression of β-actin. The primers for TSLP and β-actin were 5’- CGCTCGCCAAAGAAATGTTC/ 3’- TCTTCTTCATTGCCTGAGTAGCAT and 5’- TGGCATTGCCGACAGGAT/ 3’- GCTCAGGAGGAGCAATGATCT, respectively.

Western blot analysis of mitogen-activated protein kinases

PAR2-related activation of mitogen-activated protein kinases (MAPKs, including ERK, JNK, and p38) in HBECs were tested. The procedure to detect MAPK activity has been described in detail previously22. Briefly, HBECs were treated with HDM 200 µM for various periods (10, 30, 60, and 120 min), followed by examining immunoblots for phosphorylation of ERK, JNK, and p38, and in which ERK phosphorylation at 10 min was determined for following experiments. Subsequently, HBECs were treated with HDM 200 µM in the absence or presence of 2-h preincubation with dexamethasone (100 µM) or FSL (100 µM) or PD98059 (10 µM) for 10 min. At the end of each treatment, cells were lysed on ice in a lysis buffer. Aliquots of cell lysates were separated on 8–12% SDS-PAGE and then transblotted onto ImmobilonTM-P membrane (Millipore). After being blocked with 5% skim milk, the blots were incubated with specific primary antibodies (β-actin 1:10000 dilution; all others 1:1000), and the appropriate secondary antibodies. The specific protein bands were detected using an enhanced chemiluminescence kit (PerkinElmer). The densitometric analysis of immunoblots was performed using Quantity One Software (version 4.6.2, Bio-Rad, Hercules, CA, USA).

Treatment with conditioned medium in human fibroblasts

CM, collected after various treatments in HBECs, was added to fibroblasts to examine the effects of CM on fibroblast proliferation and collagen production. HBECs in 24-well culture plates were treated with HDM 200 µM in the absence or presence of 2-h preincubation with dexamethasone 100 µM and FSL 100 µM for 6 h, followed by collection of CM. The identical volume of CM from different treatments was concentrated to 100 µL by centrifugal concentrator (Vivaspin 2, 3000MWCO, Sartorious Company, Goettingen, Germany). An aliquot of 500 µL medium (containing 100 µL of concentrated CM mixed with 400 µL of fresh fibroblast culture medium) was added to confluent HLFs in 24-well culture plates and, HLFs were incubated for 24 h. To testify whether TSLP is the responsible material in CM, we treated HLFs with recombinant TSLP directly or with HDM (200 µM)-stimulated CM mixed with ant-TSLP neutralization antibody. Various concentrations of TSLP protein (0.1, 1, 10 µg/mL) were added to HLFs in 24-well culture plates containing 500 µL of fresh fibroblast culture medium for 24-h incubation. Similarly, HLFs were also incubated in an aliquot of 500 µL of anti-TSLP neutralization antibody (50 or 100 ng/mL) admixed with 100 µL of concentrated, HDM-stimulated CM and fibroblast culture medium for 24 h. At the end of experiments, supernatants were collected to measure soluble collagen (Sircol Collagen Assay, Biocolor Ltd., Antrim, UK) according to the manufacturer’s instructions. The fibroblast counts were calculated by automated cell counters (EVE™, NanoEntek America, Waltham, MA, USA). Cell viability was determined by light microscopy and dye exclusion with trypan blue.

Statistical analysis

Data are expressed as mean and standard error of mean (SEM) in error bar. The Kruskal-Wallis H test evaluated multiple comparisons among different experimental conditions, followed by the Mann-Whitney U test for pairwise comparisons. A two-sided P value < 0.05 is considered significant for all tests.

Results

Effect of HDM on TSLP production at protein and mRNA levels in HBECs

The effect of HDM on the production of TSLP showed a dose-response relationship at both protein and mRNA levels. HBECs stimulated with HDM 200 µM reached the maximal TSLP production at 6 h (Fig. 1) and the highest TSLP mRNA expression at 3 h (Fig. 2). Thus, HDM 200 µM was designated as the preferred concentration in the following experiments. Cell viability was around 90-95% in each experiment condition.

Fig. 1
figure 1

Effects of HDM on TSLP production. HBECs were treated with various concentrations of HDM (50, 100, and 200 µM) and incubated for different periods (3, 6, and 24 h), followed by collection of the supernatants for measurements of TSLP. The bar charts with dot plots indicate mean values with SEM in error bars. #, P < 0.05, vs. control. * P < 0.05, Mann-Whitney U test. TSLP levels (pg/mL) were generated in duplicate from 5 to 9 experiments. HDM, house dust mite. TSLP, thymic stromal lymphopoietin.

Full size image
Fig. 2
figure 2

Effects of HDM on TSLP mRNA expression. HBECs were treated with various concentrations of HDM (50, 100, and 200 µM) and incubated for 3 h, followed by cell lysis for measurements of TSLP mRNA expression. The bar chart with dot plots indicates mean values and SEM in error bars. #, P < 0.05, vs. control. * P < 0.05, Mann-Whitney U test. The mRNA expression was determined by quantitative real-time PCR in 4 to 8 separate experiments.

Full size image

PAR2 mediates HDM-induced production of TSLP in HBECs

It was further investigated whether HDM-induced TSLP production was mediated through PAR2 activation. With 2-h preincubation of PAR2 antagonist (FSL, 25 to 100 µM) and dexamethasone (100 µM), HDM-induced TSLP production was significantly suppressed at 6 h, and a dose-dependent suppression was also observed in FSL (Fig. 3). Therefore, FSL 100 µM was used in the following experiments.

Fig. 3
figure 3

Effects of PAR2 antagonist on HDM-induced TSLP production. HBECs were treated with HDM 200 µM in the absence or presence of 2-h preincubation of various concentrations of PAR2 antagonist (FSL, 25, 50, and 100 µM) or dexamethasone (100 µM) for 6 h. At the end of the experiments, the supernatant was collected for TSLP measurements using the ELISA method. The bar charts with dot plots indicate mean values and SEM in error bars. #, P < 0.05, vs. control. * P < 0.05, Mann-Whitney U test. TSLP levels (pg/mL) were generated in duplicate from 4 to 9 separate experiments. FSL, FSLLRY-NH2; Dex, dexamethasone.

Full size image

The axis of HDM-PAR2-ERK phosphorylation-TSLP production in HBECs

HBECs were treated with HDM 200 µM for various periods (10 to 120 min), followed by harvested for western blotting to observe the phosphorylation of MAPKs. Among ERK, JNK, and p38, phosphorylation of ERK peaked at 10 min (Fig. 4A and B). However, no significant reaction was observed for JNK and p38 (data not shown). With 2-h preincubation of dexamethasone 100 µM and FSL 100 µM, HDM-induced ERK phosphorylation was significantly suppressed (Fig. 4C and D). Additionally, experiments repeated with pretreatment using lower, typically effective concentrations of dexamethasone (10 nM and 100 nM) demonstrated significant inhibition of HDM-induced ERK phosphorylation and TSLP production (Fig. S1 in the supplementary file). With 2-h preincubation of PD98059 10 µM, HDM-induced ERK phosphorylation was significantly suppressed at 10 min (Fig. 5A and B), and HDM-induced TSLP production was also suppressed at 6 h (Fig. 5C).

Fig. 4
figure 4

Effects of PAR2 on HDM-induced ERK phosphorylation. HBECs were treated with HDM 200 µM for various periods (10, 30, 60, and 120 min) or treated with HDM 200 µM in the absence or presence of 2-h preincubation of PAR2 antagonist (FSL 100 µM) or dexamethasone (100 µM) for 10 min, then harvested for Western blotting (A) or (C) and comparisons of protein bands (B) or (D). Protein bands were analyzed by densitometry. The bar charts with dot plots indicate mean values with SEM in error bars. #, P < 0.05, vs. control. * P < 0.05, Mann-Whitney U test. Blots are representative of 5 to 6 separate experiments. ERK-P, phosphorylation of extracellular signal-regulated kinases; ERK-T, total ERK. Refer to Fig. 3 for other abbreviations.

Full size image
Fig. 5
figure 5

Effect of ERK inhibitor on HDM-induced ERK phosphorylation and TSLP production. HBECs were treated with HDM 200 µM in the absence or presence of 2-h preincubation of ERK inhibitor (PD 98059 10 µM) for 10 min, then harvested for Western blotting (A) and comparisons of protein bands (B). Protein bands were analyzed by densitometry. HBECs were also treated with HDM 200 µM in the absence or presence of 2-h preincubation of PD 98,059 (10 µM) and incubated for 6 h, followed by measurements of TSLP in the supernatants (C). The bar charts with dot plots indicate mean values with SEM in error bars. #, P < 0.05, vs. control. * P < 0.05, Mann-Whitney U test. Blots are representative of 3 separate experiments. TSLP levels (pg/mL) were generated in duplicate from 6 separate experiments. PD, PD 98,059. Refer to Figure for other abbreviations.

Full size image

PAR2 mediates fibroblast proliferation and collagen production through conditioned medium from HBECs

Adding HDM-treated CM to HLFs contributed to a significant increase in the proliferation of HLFs at 24 h. Additionally, CM from HBECs with 2-h preincubation of dexamethasone 100 µM and FSL 100 µM significantly suppressed HDM-induced HLF production (Fig. 6A). Similar responses were replicated in HDM-induced collagen production (Fig. 6B).

Fig. 6
figure 6

Effects of PAR2 on fibroblast proliferation and collagen production in HLFs through CM from HBECs. Conditioned medium (CM) was prepared from HBECs treated with HDM 200 µM in the absence or presence of 2-h preincubation of FSL 100 µM or dexamethasone 100 µM for 6 h. HLFs were incubated in 500 µL of a medium mixture (CM: fibroblast medium = 1:4) for 24 h, followed by fibroblast counting (A) and measurement of collagens in the supernatants (B). Bar charts with dot plots indicate mean values and SEM in error bars. #, P < 0.05, vs. control. * P < 0.05, Mann-Whitney U test. The fibroblast counts and collagen levels were generated in duplicate from 3 to 7 separate experiments.

Full size image

TSLP in the conditioned medium is responsible for changes in fibroblast activity

Direct stimulation with recombinant human TSLP (0.1–10 µg/mL) in HLFs contributed to a dose-dependent increase in fibroblast proliferation and collagen production at 24 h (Fig. 7A and B). Adding an anti-TSLP neutralization antibody (50 or 100 ng/mL) to HDM-induced CM significantly suppressed HDM-induced fibroblast proliferation and collagen production at 24 h (Fig. 7C and D). Taken together, the proposed mechanism in this study is illustrated in Fig. 8.

Fig. 7
figure 7

Effects of TSLP stimulation or suppression on fibroblast proliferation and collagen production in HLFs. Recombinant human TSLP with various concentrations (0.1, 1, and 10 µg/mL) were added to HLFs and incubated for 24 h, followed by calculating fibroblast counts (A) and measuring collagen in the supernatants (B). CM was prepared from HBECs treated with HDM 200 µM for 6 h. HLFs were treated in 500 µL of a medium mixture (CM: fibroblast medium = 1:4) containing anti-TSLP neutralization antibody (50 or 100 ng/mL) for 24 h, followed by fibroblast counting (C) and measurement of collagens in the supernatants (D). Bar charts with dot plots indicate mean values and SEM in error bars. #, P < 0.05, vs. control. * P < 0.05, Mann-Whitney U test. The fibroblast counts and collagen levels were calculated from 3 to 7 experiments.

Full size image
Fig. 8
figure 8

A proposed mechanism in this study. HDM stimulates PAR2 activation on HBECs, followed by a downstream signaling pathway through ERK phosphorylation and TSLP production, which can be suppressed by preincubation of PAR2 antagonist or ERK inhibitor. HBECs-generated TSLP in a conditioned medium contributes to fibroblast proliferation and collagen production in human fibroblasts. Based on the findings, this concept can be proved that fibroblast proliferation and collagen production in HLFs can be enhanced by recombined TSLP or suppressed by anti-TSLP neutralization antibodies. HBECs, human bronchial epithelial cells. HLFs, human lung fibroblasts.

Full size image

Discussion

The airway epithelium is pivotal in initiating and orchestrating asthma immune reactions. Cell cultures act as a good experimental tool to observe the direct effects of research interests in the absence of mediators-containing serum and complex cell-cell interactions in vivo. For instance, Paw et al.23 and Reeves et al.24 demonstrated key cellular responses such as epithelial-mesenchymal transition and fibroblast-to-myofibroblast transition when bronchial epithelial cells were exposed to stimuli like TGF-β1. Similarly, Mazio et al.25 utilized a 3D in vitro model to study epithelial-stromal interactions in cystic fibrosis, highlighting the utility of isolated culture systems for examining specific cellular behaviors. These studies, including models of fibroblast activation under controlled conditions, underscore the relevance of in vitro approaches for studying direct cellular responses without systemic mediators. In the present study, we demonstrated that HDM can stimulate HBECs to produce TSLP both at mRNA and protein levels. Subsequently, TSLP in CM can directly promote HLFs to proliferate and produce collagens. PAR2 on the HBECs mediates this process, and ERK acts as the downstream signaling pathway. PAR2 antagonist can effectively block this signaling pathway and downstream production. We discovered that the HDM-PAR2-ERK-TSLP axis in HBECs is one of the complex pathogenic pathways leading to airway remodeling in HLFs.

HBECs express a diverse set of pattern recognition receptors (PRRs) to sense various stimuli and initiate host immune response by rapidly producing chemokines and cytokines1,26,27. PARs are one subset of PRRs, and PAR2 plays a major role in asthma pathogenesis12,27. HDM aeroallergens may be derived from different species of mites. HDM harbors proteolytic activity, mainly by cysteine and serine protease, and the latter is the major activator of PAR213. Earlier, Hideaki K. et al. demonstrated that HBECs (BEAS-2B cells) treated with trypsin (a serine protease) or Alternaria extract (a proteolytic aeroallergen from the ubiquitous fungi- Alternaria alternata) produced TSLP through PAR2, which response was suppressed by siRNA for PAR229. Recently, Bizhou Li et al. found that HBECs (BEAS-2B cells) treated with Der-f3 (a major aeroallergen with serine protease from the different mite- D. farinae) contributed to PAR2 activation, phosphorylation of MAPKs (including ERK, JNK, p38) and NF-κB, and production of proinflammatory cytokines (IL-6, IL-8, and GM-CSF, but not for alarmins), and in which Der-f3-induced IL-8 production was suppressed either by inhibitors for the 3 MAPKs and NF-κB or by PAR2 knockdown with siRNA9. YJ Wang et al. reported that HBECs (A549 cells) treated Tyr-p3 (a major aeroallergen with serine protease from another mite- Tyrophagus putrescentiae) resulted in PAR2 activation, phosphorylation of ERK and p38, and increase in proinflammatory cytokines (IL-8, IL-1β, GM-CSF, TSLP, and IL-33), and these responses (except for ERK phosphorylation) were suppressed by PAR2 antagonist (GB88)28. In the present study, HDM (from D. pteronyssinus extract) promoted HBECs to produce TSLP through the PAR2-ERK (but not for JNK, p38) axis, and this process was blocked by PAR2 antagonist (FSL). Among these 4 studies, even performed in different HBECs (including primary cells or different cell lines), we observed that the stimulants, having similar proteolytic activity but deriving from different pathogens, all activated PAR2. However, the downstream responses might vary. Both Hideaki K. et al.29, and our team found HBECs produced TSLP, regardless of whether stimulants were derived from different pathogens. HBECs, in response to Der-f3, produced IL-6, IL-8, and GM-CSF, but not alarmins9, which is known as the response toward non-Th2 asthma30. In contrast, Tyr-p3 triggered HBECs to produce IL-8, IL-1β, GM-CSF, TSLP, and IL-3330, suggesting the potential to promote Th2 and non-Th2 immunity. In these reports, ERK acts as the identical downstream signal among different MAPKs irrespective of different stimulants. However, applying different methods or materials to antagonize PAR2 uniformly suppressed proinflammatory cytokines, not ERK phosphorylation. Taken together, although PAR2-mediated immune reactions in response to different proteolytic stimulants are very complicated, PAR2 plays an upstream role in modulating downstream immune responses. Thus, PAR2 blockade is considerable to stop the initiation of immune cascade reactions in the airway epithelium.

There are some comprehensive studies on how HDM allergens contribute to asthma pathogenesis, focusing on their role in disrupting epithelial barriers and inducing immune responses. Post et al.31 indicated that PAR2 activation plays a role in developing IgE responses but is not essential for HDM-induced airway inflammation and TSLP production. This highlights a more intricate relationship between HDM components and immune signaling pathways beyond PAR2. Ouyang et al.32 observed that HDM as serine proteases can drive calcium mobilization and TSLP release through PAR2 and other receptors. This underscores the multifaceted nature of HDM allergen interaction with airway epithelial cells and the broader complexity of immune signaling pathways. In our study, we found that HDM-induced TSLP production in HBECs is dependent on PAR2 activation, supporting previous findings. Additionally, our study advances the field by exploring how PAR2 antagonists affect TSLP signaling and downstream pathways, such as ERK activation. This may help to understand the mechanisms behind HDM-induced TSLP production and how targeting PAR2 could be a therapeutic strategy in asthma.

Recently, the clinical benefits of anti-TSLP antibody treatment were associated with reducing a broad spectrum of cytokines (e.g., IL-5, IL-13) and biomarkers (e.g., blood eosinophils, immunoglobulin E, fractional exhaled nitric oxide), which phenomena were observed in different severe asthma phenotypes (e.g., eosinophilic and non-eosinophil)20. These data implicate that anti-TSLP might suppress asthma inflammation at the top of the inflammation cascade, and TSLP exerts great effects on multiple cell types and pathways20,26. The effects of TSLP are exerted through the activation of the TSLP receptor, which broadly exists across the cells involved in innate immunity (including macrophages, dendritic cells, mast cells basophils, eosinophils, and ILC2s), adaptive immunity (including B cells, Th2 cells, CD4 + T cells, T regulatory cells), and structural changes (including epithelial cells, smooth muscle cells, fibroblasts)26,33,34. Among these structural cells, particularly for fibroblasts, only a few studies reported the effects of TSLP on airway remodeling to date. Jin A. et al. reported recombinant TSLP stimulated HLFs to produce collagen-I35. Jinxiang W. et al. demonstrated that overexpression of TSLP in HLFs by shRNA contributed to an increase in α-smooth muscle actin (α-SMA) and collagen I in HLFs34. Liuzhao C. et al. also reported that recombinant TSLP stimulated HLFs to produce α-SMA and collagen I. HLFs co-cultured with HBECs further aggravated the expression of α-SMA and collagen I in HLFs33. Similarly, our data showed both recombinant TSLP and HBECs-derived CM stimulated HLFs to proliferate and produce collagen. These data suggest that TSLP indeed acts as a direct regulator facilitating airway remodeling by either autocrine or paracrine effects. Moreover, TSLP orchestrates the epithelial-fibroblast paracrine interactions, enhancing the remodeling process.

The intercellular interactions between epithelial cells and fibroblasts can be assessed using either an indirect CM transfer method or a direct co-culture system. Both approaches can evaluate the effects of epithelium-derived factors, such as TSLP, on fibroblast activity, but they differ in important ways. The indirect CM approach isolates the impact of secreted factors by avoiding direct cellular interactions, allowing for a more controlled analysis of secreted mediators. However, this method lacks direct epithelial-fibroblast interactions, which might overlook some aspects of cellular crosstalk. In contrast, the co-culture system allows both epithelial cells and fibroblasts to grow together in the presence of stimuli like HDM. This setup facilitates direct cell-cell interactions and the exchange of soluble factors, more closely mimicking the in vivo environment and providing a more comprehensive understanding of intercellular communication. That said, the co-culture approach could introduce complexity, as direct cell contact may influence fibroblast activity and trigger simultaneous, two-way signaling responses36. To focus specifically on the one-way impact of HBEC-derived TSLP on HLF, we used the CM transfer method in our study.

In our study, we did not specifically measure protease activity in the experimental system. We recognize that assessing protease activity could provide valuable insight into the role of proteases and confirm whether the observed effects are indeed mediated through PAR-2. Future experiments will include protease activity assays to verify the specificity of the PAR-2 antagonist and to exclude potential interference with other protease-activated pathways.

Conclusion

In conclusion, we enrich the evidence that an HDM-PAR2-ERK-TSLP axis exists between epithelium-fibroblast paracrine interactions. PAR2 antagonism exerts therapeutic potential, which may ultimately help develop new therapeutic targets in HDM-TSLP-related pathogenesis in the future.