Introduction

Recent data on cancer rates in China reveal that there were 1,060,600 newly diagnosed cases of lung cancer and 733,300 deaths, highlighting a significant incidence and mortality rate. In China, lung cancer stands as the most prevalent and deadliest form of cancer1. Non-small-cell lung cancer (NSCLC) comprises approximately 85–90% of all lung cancer cases2. Within the NSCLC category, lung adenocarcinoma (LUAD) emerges as the most frequently occurring subtype3. Despite advancements in cancer treatment, such as the introduction of immunotherapy, the survival rate of patients diagnosed with LUAD remains poor4. Therefore, discovering biomarkers that accurately predict prognosis and guide the treatment of individuals with lung adenocarcinoma (LUAD) is crucial for improving the survival rates of these patients.

Estrogen sulfotransferase (SULT1E1), a cytoplasmic phase II enzyme, stands out among the 13 identified SULTs due to its highest affinity for estrogen. This enzyme exhibits strong binding not only to natural estrogens such as 17b-estradiol and estrone but also to artificial estrogens. Research indicates that SULT1E1 plays a crucial role as a “molecular switch” in mammary and uterine tissues, crucially regulating estrogen activity. By doing so, it prevents excessive estrogen stimulation which could lead to the formation of cancerous tumors5. Specifically, within breast or uterine tissues, SULT1E1 acts as a fundamental regulator by managing estrogen activity and maintaining local estrogen levels. This regulatory function is essential for avoiding hyperstimulation by estrogen, which could result in malignant growths. There is substantial evidence linking the activity of SULT1E1 with the prognosis of breast, endometrial, and ovarian cancers6,7,8. Furthermore, in the context of lung cancer, studies have shown that the likelihood of developing lung cancer may be influenced by a combination of the A-3037G polymorphism in the promoter region of the SULT1E1 gene and smoking9. In experimental settings using a mouse model of A549 xenograft tumors, dexamethasone treatment has been found to increase the expression of SULT1E1 in tumor tissue, consequently leading to the suppression of tumor growth10. These insights underscore the pivotal role of SULT1E1 in cancer biology. Despite the evident importance of SULT1E1 in various cancers, its role in lung adenocarcinoma (LUAD) remains poorly understood. This gap in knowledge highlights the urgent need for an extensive investigation into the function of SULT1E1 and its potential clinical utility as a biomarker for LUAD.

In this study, we conducted an in-depth analysis of the molecular characterisation and disease relevance of SULT1E1 through the utilisation of several online databases. Our findings revealed that SULT1E1 exhibited a notable differential expression in LUAD. Subsequently, we conducted a more detailed evaluation of the expression profiles and prognostic value of SULT1E1 in LUAD. This involved performing single-gene correlation and differential expression analyses, as well as functional enrichment and immune infiltration analyses of SULT1E1 in LUAD. Furthermore, Western blot, RT-qPCR, immunohistochemistry and cellular immunofluorescence were employed to corroborate the expression levels of SULT1E1 in lung cancer cell lines, LUAD tissues and normal lung tissues. Finally, clinical samples were collected to confirm whether there was a correlation between the expression level of SULT1E1 and clinicopathologic features, peripheral serologic indicators and patient prognosis. The findings of this study indicate that SULT1E1 has considerable potential as a biomarker, with the capacity to serve as a novel target for the treatment of LUAD and to facilitate effective prognosis assessment in patients.

Materials and methods

Patient population and tissue samples

A cohort of 95 patients diagnosed with lung adenocarcinoma (LUAD) and treated at the Third People’s Hospital of Yancheng City (the Sixth Affiliated Hospital of Nantong University) from January 2014 to December 2021 was selected for this study. The analysis included both clinical data—such as age, gender, smoking history, tumour stage, degree of differentiation, platelet-to-lymphocyte ratio (PLR), neutrophil-to-lymphocyte ratio (NLR), and systemic immune-inflammation index (SII)—and samples from tumour and peritumour tissue. All tissue specimens used for Western-blot experiments were placed in an ice box promptly after surgical excision and stored in liquid nitrogen after timely sampling according to the principle of sterility, and all tissue specimens used for immunohistochemistry were fixed in 10% formalin solution immediately after surgical excision, and then prepared into 5 μm-thick frozen sections and preserved at −80 degrees Celsius. Patient enrolment criteria included: (1) lung adenocarcinoma confirmed under pathological review of tissues, (2) age between 18 and 90 years old, (3) all patients fulfilled the criteria for surgery and did not undergo neoadjuvant radiotherapy, (4) no obvious contraindications to surgery, (5) no obvious endocrine system diseases and metabolic diseases, (6) no history of psychiatric disorders. All participants were followed up for more than 5 years. The study included 95 patients with lung adenocarcinoma (LUAD), with an age range of 32 to 84 years. Of these patients, 32 (33.7%) were less than 60 years of age, while 63 (66.3%) were 60 years of age or older. The gender distribution of the study population was 44.2% female and 55.8% male. A total of 53 patients were classified as having TNM stage I and II, while 42 patients were classified as having TNM stage III and IV. Histology stage was observed to be good in 48 cases (50.5%) and poor in 47 cases (49.5%). The neutrophil-to-lymphocyte ratio (NRL) was less than 2.7 in 47 cases (49%) and greater than or equal to 2.7 in 48 cases (51%), while the platelet-to-lymphocyte ratio (PLR) was less than 270 in 59 cases (62.1%) and greater than or equal to 270 in 36 cases (37.9%). The systemic immune-inflammation index (SII) was less than 330 in 63 cases (66.3%), while 32 cases (33.7%) were greater than or equal to 330. The study was approved by the Ethics Committee of the Third People’s Hospital of Yancheng City (Lun Audit-2022-99) and informed consent was obtained from all participating patients with lung adenocarcinoma.

SULT1E1 gene information

The GeneCards database (https://www.genecards.org/) was utilized for the purpose of visualizing human chromosomes and determining the subcellular locations of the gene SULT1E111. This comprehensive resource provided detailed insights into the chromosomal positioning and cellular localization of SULT1E1, contributing valuable information for genomic studies. Furthermore, the OpenTarget platform (https://platform.opentargets.org/) has highlighted a potential involvement of the SULT1E1 gene in the pathogenesis of various diseases. Through its robust analytical tools, OpenTarget identified correlations and potential mechanistic roles of SULT1E112, thereby underscoring its significance in disease development and progression.

Data collection and preprocessing

The online database TIMER (http://timer.cistrome.org/) was utilized to visually represent the varying expression of the SULT1E1 gene across different types of cancer13. Data Retrieval: Information specific to LUAD was obtained from the publicly accessible TCGA database (https://www.cancer.gov/ccg/research/genome-sequencing/tcga) and gene expression data was isolated. Grouping of Genes: Based on the expression levels of SULT1E1, the samples were categorized into high and low expression groups.

Differential expression analysis

Screening for differential gene expression: Utilizing the limma package in R language, analyses were conducted to identify genes showing differential expression. The criteria for screening included: |logFC| exceeding 1 and p-value less than 0.05.

Bioinformatics analysis of SULT1E1 expression in LUAD

Expression difference analyses were performed using the ANOVA algorithm in the Gene Expression Profiling Interactive Analysis 2 (GEPIA 2) online database (http://gepia2.cancer-pku.cn/#index)14. The log2-fold change (log2 FC) was set to 1, with a corrected P-value below 0.01. This analysis focused on comparing the expression levels of SULT1E1 in both tumour tissues and normal tissues, as well as across different stages of LUAD and lung squamous cell carcinoma (LUSC).Further quantitative analysis of SULT1E1 expression levels in tumour and normal tissues was conducted using the ENCORI online database (https://rnasysu.com/encori/)15. Additionally, a preliminary investigation into the potential relationship between SULT1E1 and LUAD clinical staging was carried out on the UALCAN online website. This multi-faceted approach provides a comprehensive understanding of the role of SULT1E1 in lung cancer progression and highlights its potential as a biomarker for disease prognosis (https://ualcan.path.uab.edu/)16.

Kaplan–Meier plot analysis

Analysis of SULT1E1 gene expression in LUAD and LUSC was conducted by assessing risk ratio (HR) and log-rank p-value through the Kaplan-Meier online tool (https://kmplot.com/analysis/)17. This analysis was performed to evaluate patients’ overall survival (OS) and post-progression survival (PPS) in both LUAD and LUSC. The Oncology Database (http://www.oncolnc.org/) was the source of data for LUAD, and GraphPad Prism 8.0 was utilized to plot Kaplan-Meier curves for OS.

Correlation expression analysis

The SULT1E1 protein-protein interaction (PPI) network was created based on data from the STRING database(http://string-db.org)18. PPIs with a score above − 0.40 were chosen for visualization. The analysis of protein-protein interactions can provide valuable insights into the functions and relationships of different proteins within a biological system. By examining the network of interactions involving SULT1E1, researchers can gain a better understanding of the role this protein plays in various cellular processes. This information can be helpful in elucidating the mechanisms underlying certain diseases or in identifying potential therapeutic targets. Understanding protein-protein interactions is essential for unraveling the complexities of biological systems. The construction of the SULT1E1 PPI network allows researchers to explore the connections between this protein and other molecules within the cell. By focusing on interactions with a score above − 0.40, the network visualization provides a clear and focused representation of the relationships involving SULT1E1. This detailed analysis can reveal key players in cellular pathways or signaling cascades that may be critical for normal cellular function or disease progression. In summary, the construction and visualization of the SULT1E1 protein-protein interaction network offer a valuable tool for studying the function and significance of this protein in biological systems. By identifying and analyzing interactions with other proteins, researchers can gain insight into the role of SULT1E1 in various cellular processes. This information can ultimately lead to a better understanding of disease mechanisms and the potential development of targeted therapies.

Functional enrichment analysis

Gene Ontology (GO) Enrichment Analysis19: A GO enrichment analysis of differential genes was conducted using the clusterProfiler package, with a focus on the three categories of biological process (BP), cellular component (CC), and molecular function (MF). The results were visualised in bubble plots and histograms.

Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis(https://www.kegg.jp/kegg/)20: A KEGG pathway enrichment analysis of differential genes was conducted using the clusterProfiler package, and the results were presented in the form of bubble plots and histograms.

Gene Set Enrichment Analysis (GSEA)21: The pathway enrichment of the SULT1E1 gene in the samples was analysed using the Gene Set Enrichment Analysis (GSEA) function in the clusterProfiler package.

Immune cell infiltration analysis

The samples were analyzed for immune cell infiltration using the CIBERSORT tool. A comparison of the proportion of immune cells between the high and low expression groups is necessary for further analysis. Additionally, correlation analysis was performed to determine the relationship between SULT1E1 expression and 24 different immune cells22. The resulting correlation heatmaps were created with the ggplot2 package for visual representation of the data. This analysis allows for a better understanding of the potential interactions between SULT1E1 expression and immune cell infiltration, providing insights into the role of SULT1E1 in the immune response. By examining these correlations, researchers can gain valuable information about the impact of SULT1E1 on the immune system and potentially identify new therapeutic targets for immune-related diseases.

Cell culture

The cell lines utilized in this study were acquired from Wuhan Pricella Biotechnology, Inc., comprising A549, H1299, H1734, H838, HCC827, Beas-2b, and H1975. These cells were maintained following a standardized protocol, using Roswell Park Memorial Institute (RPMI) 1640 medium and Dulbecco’s Modified Eagle Medium (DMEM). The basal medium was a combination of RPMI 1640 and DMEM, supplemented with 10% fetal bovine serum and 1% of a dual antibiotic (penicillin and streptomycin) to formulate the complete medium. To culture the cells, they were placed in T25 perforated cell culture flasks containing 5 milliliters of the complete medium and maintained in an incubator set at 37 °C with a 5% CO₂ atmosphere. Cells that were in the logarithmic growth phase, demonstrating optimal proliferative characteristics, were deemed suitable for subsequent experimental procedures. All the mentioned materials were sourced from China Wuhan Punosai Biological Company.

Western blotting

Total proteins were extracted from lung adenocarcinoma (LUAD) and surrounding tissue samples and cell lines with RIPA buffer (Beyotime, China), and protein concentrations were quantified using a BCA kit (Beyotime, China). The protein samples were separated by 12.5% SDS-PAGE (Epizyme, China) and then transferred to PVDF membranes (Millipore, USA). Subsequently, the membranes were incubated in 5% skimmed milk for 2 h. Following this, the membranes were washed with TBST and incubated with primary antibodies, including anti-GAPDH (Proteintech, China) and anti-SULT1E1 (Proteintech, China). Subsequently, the membrane was placed in a 4 °C environment overnight, then washed three times with TBST and incubated with secondary antibody at room temperature in the absence of light for 1 h. Next, the membrane was washed three times with TBST and then developed with an Enhanced Chemiluminescence Detection Kit (Ncmbio, China) under a Tanon-5200multl imaging system. Grey values were measured by Image J software, with GAPDH as an internal reference.

RNA extraction and RT-qPCR

Total RNA was isolated from LUAD tissues and paired normal tissues using FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme Biotech, Nanjing, China), and the RNA concentration was detected by Nanodrop 2000 (Thermo Scientific, USA). Then cDNA was synthesized using HiScript II Q RT SuperMix for qPCR (Vazyme Biotech, Nanjing, China). cDNA was detected using SYBR Green (Vazyme Biotech, Nanjing, China) and ABI QuantStudio 5Real-Time quantitative PCR system (Applied Biosystems, USA) to detect RNA expression, and the 2-ΔΔCt method was used to calculate the relative RNA amount normalized to GAPDH. All primers are shown as follows.

Gene

Sequences (5′–3′)

SULT1E1

FORWARD: CATTTGCCACCTGAACTTCTTCCTG

REVERSE: GAAACAGCCACATCCTTTGCATTCC

GAPDH

FORWARD: GTGGACCTGACCTGCCGTCTAG

REVERSE: GAGTGGGTGTCGCTGTTGAAGTC

Immunohistochemistry

The specimens were initially fixed using a 10% neutral formalin solution. They underwent a dehydration process through a gradient ethanol series before being embedded in paraffin. The specimens were then serially sectioned to a thickness of 7 μm. To detect the expression of SULT1E1, an immunohistochemical SP method was employed using a rabbit polyclonal antibody from Proteintech, China. The paraffin sections were first deparaffinised and then rehydrated using xylene provided by China Pharmaceuticals. For antigen retrieval, the sections were autoclaved. To block the endogenous peroxidase activity, a 3% hydrogen peroxide solution from Sinopharm, China was applied. To minimize non-specific protein binding, the sections were treated with normal goat serum from Phygene, China for 20 min. A solution containing SULT1E1, at a 1:1000 concentration, was placed on the sections and incubated overnight at a temperature of 4 °C. Following this, a secondary antibody was applied for 15 min at room temperature. The color was developed using 3,3-diaminobenzidine (DAB) from Beyotime, China for a period of 3–5 min. The specimens were then counterstained with hematoxylin from Phygene, China, dehydrated, and finally mounted in neutral gum. For the observation, an Olympus BX83 fluorescence microscope from Japan was utilized. The resulting interpretation of the specimens was carried out by two pathologists, each with the expertise level of an attending physician or higher. They examined the samples independently in a double-blind manner, assessing them based on the intensity and proportion of cells that were positively stained.

Immunofluorescent staining

Round Coverslip was placed into a 6-well plate, followed by the addition of cell suspension and culture medium, and after 2–3 days, the medium was aspirated and briefly rinsed with PBS and then fixed on Round Coverslip with 4% paraformaldehyde for 30 min, and washed three times with low-temperature PBS solution. Cells were subsequently incubated with PBS containing 0.1–0.25% Triton X-100 for samples to increase antibody permeability.The primary antibody was incubated for a period of 12 h at 4 °C, following a 30-min incubation at 37 °C with 10% goat serum (Beyotime, China) to facilitate antibody binding. Following a wash with phosphate-buffered saline (PBS), the samples were incubated with tetramethylrhodamine (TRITC)-conjugated goat anti-rabbit immunoglobulin G (IgG) (Beyotime, China) for 1 h, after which they were washed again with PBS. Subsequently, the nucleic acids were stained with DAPI dye, and finally, after sealing the coverslips with an anti-fluorescence quenching sealer (Phygene, China), they were observed under an Olympus BX83 fluorescence microscope (Japan).

Statistical analysis

The statistical software package SPSS 25.0 (Chicago, IL, USA) was utilized to analyze the data. The chi-square test was employed to assess the independence of categorical variables. Additionally, survival disparities were assessed via Kaplan-Meier analyses. Variables exhibiting a p-value below 0.1 in the Univariable analysis were incorporated into the Cox proportional hazards model for multivariable analysis. Significance was established with a P-value lower than 0.05.

Results

SULT1E1 localisation, expression, related diseases and pan-cancer analysis

SULT1E1 is located in region 3 of band 1 of the long arm of chromosome 4 (Fig. 1A). The protein encoded by the gene SULT1E1 is known as sulfotransferase 1E1 and is primarily found in the cytoplasm and nucleus (Fig. 1B). Through a thorough analysis of gene-disease interactions, it has been discovered that SULT1E1 is linked to a diverse array of disorders, such as genetic conditions, congenital abnormalities, metabolic issues, and cancer development (Fig. 1C). In particular, examining its expression in various cancers using data from the TCGA database revealed a significant decrease in SULT1E1 levels in tumors such as hepatocellular carcinoma, prostate cancer, and malignant melanoma. Furthermore, the expression of SULT1E1 was notably lower in LUAD compared to normal lung tissues (Fig. 1D).

Fig. 1
figure 1

(A) Chromosomal localisation of the SULT1E1 gene. (B) Subcellular localisation of the protein encoded by the SULT1E1 gene. (C) Network diagram of SULT1E1 gene-disease network interactions. (D) TIMER database showing differential expression of SULT1E1 in pan-cancer tissues (***: P < 0.001).

Full size image

Correlation between SULT1E1 expression levels in lung adenocarcinoma tissues and individual cancer stage

Analysis using the GEPIA database revealed a notable disparity in SULT1E1 expression between normal lung tissues and lung adenocarcinoma (LUAD). Specifically, SULT1E1 levels were found to be significantly lower in lung adenocarcinoma tissues compared to normal ones, with a statistical significance (P < 0.05) based on matched data from TCGA normal and GTEx. In contrast, the difference in expression of SULT1E1 in LUSC tissues and normal lung tissues was not statistically significant (Fig. 2A).The same results were obtained in the ENCORI online database (Fig. 2B). A review of the histological data available on the UALCAN website indicates a significant correlation between SULT1E1 expression and cancer stage (P < 0.001, Fig. 2C). Furthermore, analysis of the GEPIA database revealed that SULT1E1 expression levels exhibited significant differences between different stages of LUAD (F = 5.03, Pr(> F) = 0.00193), whereas no significant differences were observed in LUSC (F = 0.999, Pr(> F) = 0.393) (Fig. 2D).

Fig. 2
figure 2

(A/B) Differential expression of SULT1E1 in lung adenocarcinoma and squamous lung cancer tumour tissues and normal tissues. (C) Differential expression of SULT1E1 in different pathological stages of LUAD analysed by UALCAN. (D) Differential expression of SULT1E1 at different stages of LUAD and LUSC was analysed by GEPIA. (*: P<0.05, **: P<0.01, ***: P<0.001).

Full size image

Analysis of the effect of SULT1E1 on the prognosis of LUAD patients based on an online database

The association of SULT1E1 levels in microarray data (222940_at) with survival outcomes, including overall survival (OS) and post-progression survival (PPS), in individuals diagnosed with LUAD and LUSC was investigated using the Kaplan-Meier (KM) online platform. The findings indicated that individuals with reduced levels of SULT1E1 expression experienced notably decreased overall survival and survival post progression in comparison to those with elevated levels of expression (Fig. 3A/B). In patients diagnosed with lung squamous cell carcinoma (LUSC), individuals with low SULT1E1 expression levels displayed a shorter overall survival compared to those with high levels of expression. This suggests that SULT1E1 may play a role in determining survival outcomes in patients with LUSC. Interestingly, once patients experienced disease progression, there was no statistically significant difference in survival between those with low SULT1E1 expression and those with high expression levels. This indicates that while SULT1E1 expression may impact overall survival rates in LUSC patients, it may not necessarily influence survival after the disease has progressed(Fig. 3C/D). Further survival analysis based on the expression of SULT1E1 was conducted using the Oncolnc database, revealing a significant correlation between SULT1E1 expression levels and the prognosis of patients with LUAD. Specifically, it was observed that low expression of SULT1E1 was associated with a significantly shorter overall survival (OS) of patients (P < 0.001). These findings highlight the potential role of SULT1E1 as a prognostic marker for patients with LUAD, emphasizing the importance of monitoring its expression levels in clinical settings to inform treatment strategies and improve patient outcomes (P < 0.001, Fig. 3E).

Fig. 3
figure 3

(A/B) Analyzed the KM database to study the prognostic association of SULT1E1 expression with overall survival (OS) in patients with LUAD. (C/D) A KM database was utilized to examine the prognostic link between SULT1E1 expression and overall survival (OS) in individuals diagnosed with squamous cell carcinoma of the lung. (E) KM survival curves based on the Oncolnc database.

Full size image

Interaction network of SULT1E1

The protein-protein interaction network (Fig. 4A) was constructed using the STRING database, and the 10 highest-scoring predicted chaperone proteins were identified as follows: The top ten predicted chaperone proteins, ranked by their STRING scores, are as follows: TERT (0.996), HSD17B1 (0.962), HSD17B2 (0.959), UGT1A6 (0.959), CYP19A1 (0.959), UGT1A10 (0.958), UGT1A4 (0.958), UGT1A8 (0.957), UGT1A1 (0.956), UGT1A7 (0.955). The aforementioned proteins may interact with SULT1E1 to play a role in the development of lung adenocarcinoma (LUAD).

Enrichment analysis of SULT1E1 in LUAD

Following a detailed analysis of the SULT1E1 gene in lung adenocarcinomas, the collected samples were stratified into two distinct groups based on their expression levels. To further understand the implications of these expression levels, a differential expression analysis was conducted. This analysis identified a set of key genes, characterized by a log fold change (logFC) greater than 1 and a p-value less than 0.05, indicating statistically significant differences in gene expression between the two groups. Subsequently, a KEGG enrichment analysis was performed to elucidate the biological pathways associated with these differentially expressed genes. The results indicated several enriched pathways, including taurine and subtaurine metabolism, which is crucial for various physiological functions, the AGE-RAGE signaling pathway, significant in diabetic complications, the FoxO signaling pathway, which plays a role in cellular functions such as apoptosis and cell-cycle control, and choline metabolism in cancer, an essential pathway involved in oncogenesis and cancer progression (Fig. 4B/C). The Gene Ontology (GO) enrichment analysis revealed that the biological processes (BP) that were enriched included axon assembly, cilia movement, cilia assembly, mitosis, and so forth. Enriched cellular components (CC) include ciliary matrix, ciliary plasma, and cytoplasm. The enriched molecular functions (MF) include protein serine/threonine kinase activity, microtubule motility activity, cytoskeleton motility activity, and so forth (Fig. 4D/E). Secondly, the pathways identified as significantly enriched in the SULT1E1 high expression group by GSEA analysis included: drug metabolism-cytochrome P450, drug metabolism-other enzymes, chlorophyll and retinol metabolism and steroid hormone biosynthesis (Fig. 4F). The aforementioned outcomes indicate that SULT1E1 is implicated in a multitude of biological functions and pathways, including the potential for exerting anti-LUAD effects by influencing protein serine/threonine kinase activity and consequently inducing alterations in downstream pathways.

Relevance of SULT1E1E expression in immune infiltration

Following this, an examination was conducted to investigate the connection between immune cell infiltrations and the expression of the SULT1E1 gene in patients with LUAD sourced from the TCGA database. The findings were then presented visually through a Lollipop plot (Fig. 4G). Out of the 24 immune cell types analyzed, a significant correlation was observed between SULT1E1 expression and seven specific immune cells. The outcomes were as follows: Naive B cells (correlation coefficient = 0.120, p-value = 0.0062), M0 Macrophages (correlation coefficient = − 0.160, p-value = 0.0003), Activated CD4 memory T cells (correlation coefficient = − 0.181, p-value = 3.567e−05), Tregs cells (correlation coefficient = − 0.117, p-value = 0.0076), Monocytes (correlation coefficient = 0.126, p-value = 0.0040), M2 macrophages (correlation coefficient = 0.136, p-value = 0.0020), and Mast cells resting (correlation coefficient = 0.141, p-value = 0.0013).

Fig. 4
figure 4

(A) Protein-protein interaction network analysis of SULT1E1-related genes. (B) Bar graph for KEGG enrichment analysis of SULT1E1. (C) Bubble diagram of KEGG enrichment analysis of SULT1E1. (D)Bar graph of GO enrichment analysis of SULT1E1. (E)Bubble diagram of GO enrichment analysis of SULT1E1. (F)Gene set expression analysis. (G)Lollipop plot of the correlation between the 24-item immune cell infiltration score and SULT1E1 gene expression in LUAD patients from the TCGA database.

Full size image

Evaluation of SULT1E1 expression in human LUAD cell lines and LUAD tissues

To corroborate the positive outcomes seen in the bioinformatics analysis, we investigated the expression levels of SULT1E1 in human lung adenocarcinoma (LUAD) tissues as well as in LUAD cell lines. By employing western blot analysis, we were able to determine the expression profile of SULT1E1 in human LUAD tissues. Quantitative analysis of the grey scale values showed that the SULT1E1 expression was markedly reduced in seven pairs of fresh human LUAD tissues compared to the corresponding normal lung tissues (Fig. 5A). The expression of SULT1E1 mRNA in lung adenocarcinoma tissues and normal lung tissues was detected by RT-qPCR assay and found that the level of SULT1E1 mRNA in lung adenocarcinoma tissues was significantly lower than that in normal lung tissues(Fig. 5B). In addition, the expression level of SULT1E1 in LUAD cell lines (A549, H1299, H1734, H838, HCC827, Beas-2b, H1975) was also examined by Western blot, and it was found that compared to normal lung epithelial cells Beas-2b, the expression of SULT1E1 was significantly lower in the remaining LUAD cells, especially the difference was more obvious in both H1734 and H838 cells(Fig. 5C). It is of note that immunohistochemical staining also revealed a lower expression of SULT1E1 in lung adenocarcinoma (LUAD) tissue than in normal lung tissue (Fig. 5D). Furthermore, the distribution of SULT1E1 expression was examined using cellular immunofluorescence in two types of LUAD cells, H1299 and A549. The results demonstrated that SULT1E1 was widely expressed in the nucleus and cytoplasm (Fig. 5F), which was in accordance with the results of Fig. 1B. In conclusion, the aforementioned experimental results corroborate the hypothesis that SULT1E1 expression in human LUAD tissues is lower than in normal tissues. This finding is consistent with the results obtained through bioinformatics analysis.

Fig. 5
figure 5

(A) The Western-blot analysis was conducted to assess the levels of SULT1E1 expression in 7 pairs of LUAD tissues and their corresponding normal tissues. This was done using grey value analysis, and the findings were illustrated through bar graphs. (B) The expression levels of SULT1E1 mRNA in lung adenocarcinoma tissues and normal tissues were detected by RT-qPCR and visualized as bar graphs. (C) Western-blot assay to determine the expression level of SULT1E1 in several human LUAD cell lines with grey value analysis, and the results were visualised using bar graphs. (D) IHC staining of tumour tissues and adjacent normal lung tissues in LUAD patients. (E) Kaplan-Meier survival analysis of LUAD patients with different SULT1E1 expression levels in immunohistochemistry. (F) Cellular immunofluorescence to determine the distribution of SILT1E1 expression in H1299, A549 cells. (T is lung adenocarcinoma tumour tissue, N is adjacent normal lung tissue, *: P < 0.05, **: P < 0.01, ***: P < 0.001).

Full size image
Table 1 Relationship between SULT1E1 expression and clinicopathologic features of lung cancer patients.
Full size table
Table 2 Univariable and multivariable analysis of prognostic factors of 5-year overall survival in lung cancer patients.
Full size table

Correlation analysis of SULT1E1 expression with LUAD clinicopathologic parameters

To investigate the relationship between SULT1E1 expression levels and the clinicopathological characteristics of LUAD, all LUAD patients were categorized into either high or low expression groups based on their SULT1E1 expression grades (Table 1). The expression level of SULT1E1 in LUAD was found to correlate with TNM stage (P < 0.001), histological stage (P = 0.031), and it should be noted that the expression level of SULT1E1 also correlated with peripheral serological indicators, which included NRL (P = 0.018), PLR (P = 0.042), and SII (P = 0.011). This indicates that SULT1E1 is not only associated with cancer, but may also have a high predictive value for inflammation and prognosis. It is also noteworthy that the expression level of SULT1E1 in LUAD was not statistically significantly different from age, gender, and smoking history (P > 0.05).

Prognostic significance of SULT1E1 expression in LUAD

One-way Cox regression analysis demonstrated that SULT1E1 expression level (P = 0.002), TNM staging (P < 0.001), histological stage (P < 0.001), NRL (P = 0.025), PLR (P = 0.048), and SII (P = 0.022) were significant prognostic factors for lung adenocarcinoma (LUAD) (Table 2). A multifactorial Cox regression analysis (Table 2) revealed that TNM (P < 0.001), histology stage (P = 0.004), and NRL (P = 0.048) were independent prognostic factors for LUAD. In contrast, no statistically significant difference in SULT1E1 expression was identified in the multifactorial Cox regression analysis. The Kaplan-Meier survival curve demonstrated a significant association between SULT1E1 expression and OS in LUAD patients. Low SULT1E1 expression was also significantly associated with shorter OS (Fig. 5E).

Discussion

Despite remarkable progress in lung cancer treatment, the disease continues to be the primary cause of sickness and death, especially in non-small cell lung cancer (NSCLC), with a persistently low 5-year survival rate23. The exploration of gene targets associated with lung adenocarcinoma (LUAD) has emerged as a prominent area of interest among researchers worldwide. Uncovering novel biomarkers and delving into their intricate molecular mechanisms stands as a promising avenue for enhancing the overall survival outcomes of individuals battling LUAD. Currently, there exists a notable scarcity of research focusing on SULT1E1 in NSCLC, both domestically and internationally, with no documented studies specifically related to LUAD. Nonetheless, SULT1E1 exhibits pervasive expression across various human organs and tissues, encompassing non-reproductive organs like the lungs, trachea, liver, kidneys, bladder, and placenta. This broader distribution implies a functional role of SULT1E1 beyond its reproductive functions24,25. The study found that high levels of SULT1E1 can effectively slow down tumor growth by triggering programmed cell death and preventing the advancement of the cell cycle within tumor cells. In addition, increasing the expression of SULT1E1 was seen to impede the movement and infiltration of tumor cells. This suggests that up-regulating SULT1E1 could be a potential strategy for inhibiting cancer progression and metastasis26. The expression of SULT1E1 is believed to play a significant role in regulating the development of tumors. By intervening in its expression, it may be possible to effectively suppress the proliferation and metastasis of tumor cells, ultimately leading to better prognoses for patients with tumors. Studies have shown that SULT1E1 is typically expressed in normal breast cells, but its expression is often reduced or absent in breast cancer tissues27. This trend has also been observed in endometrial cancer cases28. Additionally, research has indicated that high levels of SULT1E1 can inhibit the growth of lung adenocarcinoma cell xenograft tumors and there is a clear association between SULT1E1 expression and the pathological type of malignancy5,10. These findings suggest that targeting SULT1E1 expression may hold promise in the treatment and management of various types of tumors. In light of the aforementioned evidence, it is reasonable to hypothesize that SULT1E1 may also play a role in regulating LUAD. Furthermore, it can be postulated that SULT1E1 expression is significantly associated with the prognosis of LUAD. The objective of this study was to substantiate this hypothesis. To this end, the expression and function of SULT1E1 were analysed and verified bioinformatically.

GEPIA2 was initially utilized to verify that the expression of SULT1E1 in LUAD tissue was notably reduced compared to normal lung tissue. Subsequent western blot analysis further supported this finding by demonstrating lower levels of SULT1E1 expression in the majority of LUAD cell lines (549, H1299, H1734, H838, HCC827, H1975) in comparison to normal lung epithelial cells (Beas-2b). The expression of SULT1E1 in primary LUAD tissue was found to be lower compared to normal lung tissue. Analysis using the UALCAN website and KM database revealed a significant correlation between SULT1E1 expression and different cancer stages, with low SULT1E1 levels linked to poor overall and post-progression survival. Immunohistochemical results combined with clinically collected data further indicated that the expression level of SULT1E1 in LUAD correlated with TNM staging and Histology stage of LUAD.Survival analysis underscored the value of SULT1E1 as a prognostic indicator for LUAD, with its expression level significantly impacting the overall survival of LUAD patients (P = 0.0015). Notably, decreased SULT1E1 expression was indicative of worse overall survival. Univariable Cox regression analysis validated SULT1E1 expression as a prognostic factor for LUAD, while multivariable Cox regression analysis did not show a significant statistical difference in prognosis among LUAD patients, possibly due to limited sample size and single-center follow-up. Future plans include enlarging the sample size and extending follow-up duration.

This study also incorporated composite indicators of inflammation, including markers like NLR and PLR. Inflammation is recognized to contribute to tumor development and is considered the seventh hallmark of tumors29,30. The hypothesis of inflammation-cancer transformation was first proposed 160 years ago31. A study by Xu et al. demonstrated that NLR can be employed to identify high-risk individuals, can serve as a diagnostic marker for NSCLC, and predicts lymph node metastasis32. A meta-analysis of 7283 lung cancer patients revealed that high NLR was associated with poor patient prognosis and significantly correlated with progression-free survival and OS in lung cancer33. These findings are in accordance with the results of the aforementioned study. The prognostic role of PLR in lung cancer remains a topic of contention, with some studies indicating that PLR can assist in distinguishing between lung cancer patients and healthy individuals and may possess diagnostic value32. Extensive evidence exists demonstrating the prognostic value of SII in a wide range of cancers34. The analysis of this study revealed a significant correlation between SULT1E1 expression in LUAD patients and NLR, PLR, and SII (Table 1). Univariable Cox regression analysis demonstrated that NLR, PLR, and SII could all be used as prognostic factors for LUAD. However, multivariable Cox regression analysis indicated that only NLR could be used as an independent prognostic factor, which may be attributed to the limited sample size of a single centre and the potential for confounding factors in patients receiving subsequent treatment. The above results suggest that SULT1E1 may be involved in the regulation of inflammation-related factors and signaling pathways to play a role in suppressing cancer development. In addition, this also demonstrates that SULT1E1 has a great potential to be a prognostic marker and diagnostic value for LUAD as a cancer suppressor gene in LUAD.

The next step was to conduct a comprehensive analysis of the mechanism of action of SULT1E1 in LUAD. This involved the analysis of genes that were significantly associated with SULT1E1 using TCGA data and protein-protein interaction (PPI) networks. These genes may form a regulatory network with SULT1E1, thereby inhibiting the progression of LUAD.

KEGG enrichment analysis revealed that SULT1E1 was enriched for the FOXO signaling pathway. This pathway is thought to play an oncostatic role in a variety of cancers and is involved in a variety of cellular functions, including cell differentiation, apoptosis, cell proliferation, DNA damage and repair, and as a mediator of oxidative stress35,36. The most significant pathway by which FOXO interacts with different types of cancer is the PI3K/AKT signaling pathway37. It is noteworthy that FOXO is a downstream target gene of AKT (serine/threonine protein kinase). Furthermore, GO enrichment analysis demonstrated that the molecular functions enriched by SULT1E1 were mainly regulated, including protein serine/threonine kinase activity. This suggests that SULT1E1 may exert its anti-LUAD effects through the AKT/FOXO signaling axis. These effects include pro-tumour cell apoptosis, anti-tumour cell proliferation and oxidative stress. Furthermore, the results of the KEGG enrichment analysis indicated that SULT1E1 may regulate the cell cycle and choline metabolism in cancer, which could be a potential anti-tumour mechanism. Adding to this, GO enrichment analysis revealed that SULT1E1 was predominantly enriched in the cytoplasm, which is consistent with our results of analysing the subcellular localisation of SULT1E1. The Gene Set Enrichment Analysis (GSEA) revealed that the pathways significantly enriched in SULT1E1 were mainly those involved in drug metabolism and hormone synthesis, among others. The combined results of the KEGG enrichment analysis and the GSEA analysis suggest that SULT1E1 may be involved in metabolism-related pathways, including bile acid metabolism and lipid metabolism. The above biological functions of SULT1E1 need to be elucidated by further experiments.

The results of the immune infiltration analysis indicated that SULT1E1 expression was associated with a variety of immune cells, suggesting that SULT1E1 may be involved in immune regulation in tumours. It is noteworthy that SULT1E1 expression was negatively correlated with Treg cell infiltration. Treg cells are a well-recognised immunosuppressive cell that contribute to tumour progression by releasing immunosuppressive cytokines that weaken the lethality of T cells against the tumour. Therefore, targeting SULT1E1 may be one of the potential directions for LUAD immunotherapy.

The objective of this study was to ascertain the differential expression of SULT1E1 in lung adenocarcinoma (LUAD) tissues and normal tissues. Our results revealed that SULT1E1, as a tumour suppressor gene, is strongly associated with the prognosis of LUAD. Additionally, the expression of SULT1E1 was significantly correlated with the indicators of the inflammatory complex. Furthermore, bioinformatics analysis suggests that the anticancer effect of SULT1E1 may be mediated by the AKT/FOXO signaling pathway, which exerts anti-proliferative or pro-apoptotic effects. In addition, SULT1E1 may exert anticancer effects by regulating the cell cycle, choline metabolism and immune function. However, as previously stated, this paper solely validated the differential expression of SULT1E1 through experimentation, and did not extensively examine the potential impact of SULT1E1 on the proliferation, invasion, and migration phenotypes of LUAD cells. The biological functions performed by SULT1E1 are also only at the level of bioinformatics analysis. Consequently, the objective of the forthcoming study is to analyse the effect of SULT1E1 on the phenotype of LUAD cells by means of knockdown and overexpression of the SULT1E1 gene in LUAD cells. Furthermore, the specific mechanism of SULT1E1 as a cancer suppressor will be verified through animal and cell experiments.On this basis, we considered the analysis and detection of the A-3037G polymorphism in the SULT1E1 promoter region to explain the low expression of SULT1E1 in tumors. Furthermore, it is necessary to expand the clinical sample size in order to enhance the reliability of the results and minimise the potential for error.

Conclusions

In conclusion, the present study conducted a comprehensive analysis of the expression pattern and prognostic relevance of SULT1E1 in LUAD. The results demonstrated that SULT1E1 exhibited low expression levels in LUAD, while in normal lung tissues, SULT1E1 exhibited high expression levels. It is of note that SULT1E1 expression was found to be an independent prognostic factor associated with overall survival (OS). In conclusion, the present study provides a reliable basis for the assertion that SULT1E1 can be a potential prognostic marker for LUAD and points the way for future research targeting SULT1E1.