Introduction

Eucommia ulmoides Oliver (E. ulmoides) is a perennial woody plant with dioecious reproductive characteristics, possessing significant medicinal and economic value1,2. The plant’s utilization value is influenced by its sex3,4. This rubber is renowned for its exceptional insulation properties and finds extensive application in aerospace and military materials5,6. The seed coat of female E. ulmoides plants is abundant in gutta-percha, exhibiting a high extraction rate and low impurity content. Consequently, female plants are preferred for gutta-percha extraction7. Conversely, in traditional medicine, the male flowers of E. ulmoides plants are highly valued for their health benefits, particularly in the form of herbal teas8,9. Overall, female and male trees differ in their application, but both have important value10,11. However, due to the perennial nature of E. ulmoides, determining its sex through morphological and cytological analyses before flowering is complex, often necessitating a minimum of ten years of growth before differentiation is possible12. As a result, selecting male and female E. ulmoides plants becomes challenging.

Grafting is a physiological process in which a scion with buds or branches is combined with another rootstock with roots to create a complete plant through plant regeneration13,14. This technology has been practiced for centuries in horticulture and play an essential in domesticating certain woody plants like apples, pears, and plums. It enables the asexual propagation of desirable plants that are highly heterozygous and do not readily root from cuttings15. Currently, gender selection through grafting has been adopted in production and is extensively employed in seedling breeding, new variety development, and variety improvement 16,17,18. However, the survival rate of grafted plants can be influenced by various factors. Studies have revealed that the graft survival rate is negatively correlated with the age and diameter of the scion at breast height19. Additionally, temperature and humidity also impact the graft survival rate20. Furthermore, the duration of scion retention and the affinity between the rootstock and scion are crucial factors affecting the survival rate of grafted plants21. In the case of E. ulmoides, a woody plant, the grafting survival rate is relatively low, posing a constraint to the application of grafting technology in breeding male and female E. ulmoides22.

Glucanase, is a key enzyme involved in the hydrolysis of plant cell walls. According to its mode of action, it can be divided into three types: endo-1, 4-β-glucanase, exo-1, 4-β-glucanase and β-glucosidase23. β-1, 4-glucanase has been widely used in biotechnology and industrial fields24,25,26. Research has demonstrated that the intermediate scion of Petunia hybrida or Nicotiana benthamiana can greatly improve the cell adhesion between grafted plants and promote cell fusion to improve the survival rate of grafting. This adhesive effect is attributed to the presence of β-1, 4-glucanase, an enzyme that is naturally induced during plant growth and development27,28,29,30. The β-1, 4-glucanase facilitates cell fusion at the interface between the grafted plant’s rootstock and scion, thereby greatly enhancing the survival rate of grafted plants. It has been shown that WUSCHEL-RELATED HOMEOBOX13 (WOX13), is a key regulator of healing tissue formation and organ adhesion31. The Wound-induced DEDIFERENTIATION 1 (WIND 1), is also important for healing tissue formation at the spike site32. Recent studies have shown that the PAT gene family is a conserved regulator of graft healing and tissue regeneration that promotes the formation of healing tissue13,15. In a previous study, we observed that overexpression of the EuEG1 gene, an important regulator of grafting, contributes to the survival of micrografts in E. ulmoides, suggesting that the presence of the EuEG1 gene promotes wound healing, however, whether the application of exogenous E. ulmoides β-1, 4-glucanase can also improve graft survival remains unknown2. To develop a novel engineering yeast hat can produce β-1, 4-glucanase efficiently and improve the survival rate of E. ulmoides grafting, the expression system of Pichia pastoris was used to express β-1, 4-glucanase of E. ulmoides grafting, and its application in E. ulmoides grafting was studied. It provides technical support and theoretical guidance for the large-scale industrial production of β-1, 4-glucanase. At the same time, it also provides ideas for E. ulmoides single sex breeding.

Materials and methods

Materials

The seeds were collected from E. ulmoides in the experimental base of Guizhou Academy of Agricultural Sciences (Guiyang, China).

In this study, E. ulmoides seedlings were selected as scions. To prepare the seedlings, the seed coat of E. ulmoides was carefully removed. Subsequently, the seeds were soaked in a 400 mg/L gibberellin solution for 10 h. The treated seeds were then placed in a seed germination tray filled with nutrient-rich soil and placed in a greenhouse. Regular watering was provided to ensure proper growth. The seedlings were deemed suitable for grafting when they reached a height of approximately 10 cm, had a diameter of about 0.5 cm, and exhibited slight lignification.

Gene cloning and codon optimization

The full-length primers were designed according to the reference sequence of E. ulmoides β-1, 4-glucanase gene (EuEG1). The cDNA of E. ulmoides was utilized as the template, and Platinum®Taq DNA high-fidelity polymerase (Invitrogen) was employed for amplification. The forward primer sequence was ATGGTTCCCACTTACAGTC, while the reverse primer sequence was TTAAGGTGCTAATGGATATTCTTG. DNA 2.0 software was used to optimize the codon of EuEG1 gene based on the Pichia Pastoris codon usage preference table33. The optimized gene sequence was sent to Wuhan Transduction Biology Company for gene synthesis.

Preparation and induced expression of Pichia pastoris

Restriction endonuclease sites EcoR I and Not I with protective bases were added to both ends of the EuEG1 gene sequence. After double digestion of the vector pPIC9K and EuEG1 gene, T4 DNA ligase was used to ligate, and the products were transformed into Escherichia coli. The specific protocol employed for this procedure was adapted from Liu et al.'s method34. Next, the constructed vector was digested by Sac I single enzyme and the linear plasmid was transformed into competent yeast GS115 cells by electroporation. The single colonies growing on the MD plate were placed on the MM plate successively and cultured at 30 ℃ for three days. Strains that grow normally on the MD plate but grow small or not long on the MM plate are Muts type, and the rest are Mut+ type. Mut+ type recombinant yeasts were selected, and genomic DNA was extracted for PCR validation35.

Ten positive clones were selected and inoculated in 10 mL YPD medium and cultured at 28.5 ℃ and 220 rpm to the logarithmic growth stage to make seed solution. 200 µL seed solution was inoculated into 200 mL BMGY medium and cultured at 28.5 ℃ and 220 rpm to OD600 = 5. After centrifuging the cell suspension, the resulting biomass was thoroughly resuspended in 200 mL of BMMY medium and induced at 28.5 °C with shaking at 220 rpm for 70 h in the presence of 1% methanol.

Western blot experiment

Transfer the protein sample on the gel to polyvinylidene fluoride (PVDF) film, add appropriate transfer buffer, soak the incubated film at room temperature for 1 h, and then immerse the film in primary Anti-6X His Antibody diluted with a closed solution, incubate the film at 37 ℃ for 1–2 h. Goat Anti-Mouse IgG Antibody diluted with a closed solution was soaked and incubated for 1 h. Finally, tetramethylbenzidine was used to make the transfer film color, and the images were captured and recorded by Bio-Rad gel electrophoresis imager. For details, refer to Springhorn et al.36.

Identification of target proteins by mass spectrometry

Sticky strips of target proteins were obtained by SDS-PAGE electrophoresis, and then enzymolysis of the sticky strips was performed. Protein spectrometry technology and the uniprot database were used to analyze the relevant information such as the charge and peak map of protein fragmentation obtained. For specific methods, refer to Cottet-Dumoulin et al.37.

Fermentation condition optimization

The initial OD600 for the liquid culture was set to 1, and the culture was maintained at 250 rpm. To optimize the fermentation conditions, various factors were considered: the induction time (0 h, 24 h, 48 h, 72 h, 96 h, 120 h, 140 h), the optimal initial induction pH (4, 4.5, 5, 5.5, 6, 6.5, 7), induction temperature (26 ℃, 28 ℃, 30 ℃), and methanol content (0.25%, 0.5%, 1.0%, 1.5%, 2.0%, 2.5%, 3%). After each single factor experiment, orthogonal experiment with four factors and three levels was designed to further optimize the fermentation conditions. According to the final bacterial growth and the change of β-1, 4-glucanase activity and the optimal fermentation conditions, the conditions were used to expand the cell culture.

Purification of β-1,4-glucanase

In order to avoid damaging the protein activity, the protein was concentrated by ammonium sulfate salting out method. The target protein was precipitated using an ammonium sulfate solution with a saturation level of 65%. The ammonium sulfate solution was gradually added to the supernatant, and the mixture was then sealed and left to rest overnight at 4 ℃ for complete precipitation. On the following day, the solution was centrifuged at 4 ℃ and 10,000 rpm for 10 min, and the resulting precipitate was collected. The collected precipitates were dissolved again in ddH2O. Dialysis was performed using dialysis bags with a molecular weight cutoff of 3000 Mw to remove the excess salt ions and desalt the protein. The dialysis protocol was adapted from Scheich et al.’s method38. The purification of the protein was carried out using nickel columns. The specific purification method can be found in Sun et al.’s work39. Finally, the enzymatic activity assay method for β-1, 4-glucosidase can be referenced from Mei et al.40.

Application of β-1,4-glucanase in Eucommia ulmoides grafting

Three repetitions (50 plants per group) were performed by split-grafting method, and E. ulmoides plants with similar rootstock and scion stem thickness were selected. The rootstocks were cut horizontally from the root at a distance of 5–6 cm, and a wound of 8–15 mm long was cut vertically from the cross-section with a grafting knife. On the lower end of the young stem of the scion, wedge-shaped wounds of 8–15 mm were created on both sides. The enzyme used in the experiment was applied to the grafting wound. The scion was aligned with the rootstock and quickly inserted, ensuring a tight fit of the incision. The interface was wrapped with a plastic film, and the wound was secured using a grafting clip29.

The grafted wounds at 0 day, 3 days, 7 days and 14 days were directly cut and soaked in FAA fixing solution (70% alcohol), and the paraffin sections were made by Wuhan Seville Service Biological Company Biotechnology company.

qRT-PCR analysis

Samples of stem segments of the scion wound at 0 day, 3 days, 7 days, and 14 d ays after grafting were collected and stored in a − 80 ℃ freezer after flash freezing with liquid nitrogen. Total RNA from each part was extracted and reverse transcribed into cDNA. The qRT-PCR was used for relative gene expression analysis. The primers were EuEG1-F: GGTTTGGAGACCACTACCCG, EuEG1-R: GTGTGTTTGGGTTGGGTTCG, EuWOX13-2-F: GGTCTGAGGGCATGTGTTTT, EuWOX13-2-R: TTGGAGATATGGGTGGTGGT. The EuActin gene was used as the internal reference gene, and three biological and technical replicates were performed for each sample.

Statistical analysis

The value of each physiological index and target gene were expressed as mean ± standard error (± SE). Bar charts and line charts were generated by GraphPad Prism 6.0 software (http://www.uone-tech.cn/graphpad-prism.html).

Results

Cloning of β-1, 4-glucanase gene and codon optimization

A gene encoding β-1, 4-glucanase was cloned from the cDNA of Eucommia ulmoides. The full-length gene was found to be 1917 bp and encoded a protein consisting of 638 amino acids (Fig. S1A). To align with the codon usage preferences of Pichia pastoris, the nucleotide sequence of the β-1, 4-glucanase gene was optimized. This optimization was carried out based on the frequency table of codon usage for Pichia pastoris while ensuring that the amino acid sequence remained unchanged. The specific locations of the optimization sites are shown in the red part of Fig. S1C. The optimized sequence was synthesized by HuaDa Gene. The target gene was then constructed using the pPIC9K vector. After the recombinant plasmid was transformed into Escherichia coli, confirmation of the successful construction of the recombinant vector was achieved through double enzyme digestion verification. The appearance of the target band at 1617 bp in Fig. S1B indicated the successful construction of the recombinant vector (Fig. S2).

Preparation and induced expression of Pichia pastoris

The recombinant plasmid containing the target gene was introduced into Pichia Pastoris GS115 receptor cells, and a single bright band with the size of 500-750 bp was obtained by PCR, indicating that more Mut + positive clones were obtained (Fig. S3). The engineered yeast cells were then induced for protein expression. The supernatant of the culture medium was subjected to western blot analysis using Anti-6X His Antibody as the primary antibody and Goat Anti-Mouse IgG Antibody as the secondary antibody. This assay aimed to detect protein secretion and expression. The results revealed that the target protein, produced by the engineered Pichia pastoris, was present in the supernatant of the medium, indicating successful protein secretion and expression. The protein expression efficiency was deemed satisfactory, confirming the successful preparation of the engineered yeast β-1, 4-glucanase from E. ulmoides (Fig. 1A). Furthermore, western blot analysis showed that the expressed target protein exhibited a molecular weight range between 130 and 250 KDa, whereas the predicted molecular weight of the target protein was 60 KDa (Fig. 1B).

Fig. 1
figure 1

Induced expression of Pichia pastoris. (A) Western blot results; M: Protein marker, 1-10: Positive colonies detected by PCR, -: Negative control (not induced). (B) Western blot results; M: Protein marker, 1: Negative control (no induction), 2: Results of culture medium supernatant detection.

Full size image

Mass spectrometry identification

To further verify whether the expressed protein is the target protein, protein mass spectrometry analysis was performed on the expressed protein. Figure 2 shows the secondary mass spectrometry peak of the peptide segment after trypsin digestion of the expressed protein. The protein mass spectrometry identification results suggested that a total of 24 peptides were identified, with a protein sequence coverage rate of 67%. The combination of protein mass spectrometry identification and the expression of protein bands detected by specific antibodies provided evidence that the expressed protein indeed corresponded to the target protein. Moreover, the results obtained from SDS-PAGE and western blot analysis indicated the likelihood of the expressed protein existing in the form of polymers, possibly with significant glycosylation.

Fig. 2
figure 2

Identification results by mass spectrometry. (A) Identification of proteins after trypsin digestion by MS. (B) Protein spectrum analysis. Note: The matched peptide segments are shown in the shadow.

Full size image

Optimization of fermentation conditions for Pichia pastoris and amplification culture

The optimization of induction time, initial pH, induction temperature, and methanol addition for β-1, 4-glucanase production in Pichia pastoris was performed. The results, as depicted in Fig. S4, indicated the effects of these variables on OD600 and β-1, 4-glucanase activity during cell growth. Based on the observed changes, it can be concluded that the optimal conditions for inducing β-1, 4-glucanase expression in Pichia pastoris are as follows: induction time of 96 h, initial pH of 6.0, induction temperature of 28 ℃, and methanol addition amount of 1.5%. Under these conditions, the obtained β-1, 4-glucanase activity through fermentation was found to be the highest.

After fermentation in a 30 L volume under the optimal conditions induction time: 96 h, initial pH: 6.0, induction temperature: 28 °C, methanol dosage: 1.5%, the β-1, 4-glucanase was obtained. The crude enzyme solution generated during fermentation was concentrated and dialyzed before protein separation and purification using Ni–NTA. The target protein was eluted using an elution buffer at a concentration of 200 mM. The purified protein was then analyzed using SDS-PAGE, revealing a distinct single band (Fig. 3A). To confirm the identity of the purified protein, western blot analysis was conducted using Anti-6X His Antibody as the primary antibody and Goat Anti-Mouse IgG Antibody as the secondary antibody. The obtained results, illustrated in Fig. 3B, verified the successful purification of the protein, confirming its identity as the target protein. The presence of enzymatic activity in the β-1, 4-glucanase expressed by Pichia pastoris was demonstrated through the DNS chromogenic reaction. The enzyme activity was determined to be 286.35 U/mL, further confirming the functionality of the purified protein (Fig. S5).

Fig. 3
figure 3

Results of expanded culture of β-1, 4-glucanase produced by yeast engineering bacteria. (A) SDS-PAGE analysis of purified samples; M1, M2: protein Maker, 1: Purified protein bands. (B) Western Blot analysis of purified protein samples; M1: protein Maker, 1: Purified protein bands.

Full size image

Application of β-1, 4-glucanase in Eucommia ulmoides to improve the grafting survival rate

β-1, 4-glucanase was used in the grafting of Duchess, and it was found to promote cell fusion in the grafted wounds (Fig. 4). The highest average survival rate (65%) was observed in grafted Duchess at a concentration of 5 mg/mL after 14 days (Table S1). The grafting site was dissected to observe the different motifs. On the third day after grafting, a darker layer known as the isolation layer (IL) appeared at the interface cross-section. The isolation layer effectively separates the internal tissues from the external environment and marks the beginning of the rootstock’s healing process. Meanwhile, cells near the graft wound continue to degrade and necrose, resulting in a gradual thickening of the isolation layer. On the seventh day after grafting, an isolation layer was still present at the graft wound of the tea tree with an enzyme concentration of 0 mg/mL. However, at the graft wound with 5 mg/mL enzyme concentration, the isolation layer gradually thinned and broke through due to the continuous division of thin cells in the inner layer of the rootstock formation layer, resulting in the appearance of some healing tissues. Histological observations on the 14th day after grafting revealed that the healing tissues at the graft wound site had an enzyme concentration of 0 mg/mL. The healing tissues also formed clusters and differentiated into new cells of the formation layer. When the enzyme concentration was 5 mg/mL, the healing tissue started to grow and differentiate. The formation layer of the healing tissue was attached to the rootstock for scion formation, which was beneficial for the healing of the graft wound (Fig. 5). The expression levels of EuEG1 and EuWOX13-2 genes were increasing throughout the process, reaching a peak at 7 days of grafting and then decreasing. However, EuEG1 and EuWOX13-2 increased slowly in the grafted group without the application of β-1, 4-glucanase, and the above experimental results indicated that β-1, 4-glucanase promotes faster healing of grafted wounds (Fig. 6).

Fig. 4
figure 4

Application of β-1, 4-glucanase to Eucommia ulmoides grafting. (A) Changes of scion in different periods; a: Scion growth condition after 1 day grafting, b: Scion growth after grafting for two months, c: Scion growth after grafting for four months. (B) Healing status of grafting wounds; a: Healing status after 1 day grafting, b: Healing status after 3 days grafting, c: Healing status after 7 days grafting, d: Healing status after 14 days grafting, e: Wound magnification after 14 days grafting.

Full size image
Fig. 5
figure 5

Changes of cross section of graft wound at 0 day, 3 days, 7 days, and 14 days at different concentrations of β-1, 4-glucanase. St: Rootstock; Sc: Scion; IL: Isolation Layer; Ci: Callus; Ca: Cambium; V: Vascular rays.

Full size image
Fig. 6
figure 6

Relative expression level of EuEG1 gene and EuWOX13-2 in grafted Eucommia ulmoides. CK: grafted E. ulmoides at 0 mg/mL enzyme concentration; Exogenous applied enzyme: grafted E. ulmoides at 5 mg/mL enzyme concentration. Different capital letters indicate a significant difference (P < 0.01).

Full size image

Discussion

Eucommia ulmoides is a dioecious plant that only flowers after ten years of cultivation, which presents a current challenge for gender selection and breeding in production1,4,41. Grafting has been utilized in production for gender selection and breeding of E. ulmoides; however, the grafting survival rate is low. Studies have found that β-1, 4-glucanase can enhance cell fusion between the rootstock and scion of grafted plants, thereby increasing graft survival rate, which plays a role in cellulose digestion and cell wall relaxation or construction during plant growth42,43.

The gene family of β-1, 4-glucanase has been extensively studied across various species. Overexpression of GH9Bs in poplar reduces the cross-linking of microfibrils between xylan and cellulose, thereby increasing the plasticity of the cell wall44. Cellulose, the primary component of plant cell walls, can be targeted by β-1, 4-glucanase, which catalyzes its decomposition. Transcriptome analysis of interfamily grafting in Petunia hybrida revealed a consistent increase in the expression of GH9B3, a gene encoding β-1, 4-glucanase. This suggests that solanaceae plants have the ability to modify the regulatory mode of GH9B3 gene expression, and allow tissue fusion with other species43. Also, the absence of specific motifs and promoter-related elements in the GH9B3 protein sequence in pepper plants may lead to graft failures28.

This study cloned the coding gene EuEG1 for β-1, 4-glucanase from Eucommia ulmoides and expressed it in Pichia pastoris. While inducing expression in the positive strains, it was observed that the protein bands detected by western blot did not correspond to the theoretical molecular weight of the recombinant β-1, 4-glucanase. This discrepancy may be due to the formation of protein polymers and glycosylation modification during the expression process, which lead to the increase of molecular weight of the target protein. To enhance the protein expression efficiency of the engineered yeast, the induction fermentation conditions were further optimized, and the culture of the engineered yeast was expanded, leading to the successful in vitro purification of β-1, 4-glucanase. This protein can enhance the healing of rootstock scions at the grafting site, thus improving the grafting survival rate, with 5 mg/mL identified as the optimal concentration for the survival rate of grafted plants. The application of β-1, 4-glucanase to the grafting wound led to significant healing within 14 days and a significantly increased survival rate. Previous laboratory studies have indicated that overexpression of the EuEG1 gene can facilitate the fusion of grafting wounds, with the authors speculating that this is due to increased endogenous enzyme expression2. In the study of oriental melon grafted onto squash by Xu et al., exogenous NAA treatment can induce up-regulation of auxin biosynthesis gene, which reaches a peak value during callus formation, thus promoting callus formation and vascular bundle bridging, and promoting graft wound healing45. Salama et al. found that in grafted grapes after exogenous application of ABA and other hormones, the expression of chalcone synthase (CHS) gene, flavanone 3-hydroxylase (F3H) gene and UDP-glucose-flavonoid 3-O-glucosyltransferase (UFGT) biosynthesis gene have increased46. Interestingly, this study found that, apart from assisting with the healing process, exogenous enzymes can also enhance the expression of endogenous genes, increase the content of endogenous enzymes, and further promote wound healing. Exogenous enzymes may affect the expression of wound healing genes in a variety of ways, such as by regulating the degradation of extracellular matrix, promoting cell migration and proliferation, thereby accelerating wound healing, or by activating specific signaling pathways (MAPK, PI3K/Akt), regulating gene expression related to cell proliferation and migration. In our experiments, we observed that the expression levels of wage-healing related genes were significantly up-regulated after exogenous enzyme treatment. This may be related to the activation of transcription factors by enzymes. After exogenous administration of β-1, 4-glucanase protein, β-1, 4-glucanase gene was stimulated, and the expression level of β-1, 4-glucanase gene continued to increase in the early stage of callus formation. β-1, 4-glucanase protein and β-1, 4-glucanase gene synergistically promote the division of parenchyma cells in the inner layer of rootstock and scion, gradually thinning the isolation layer and breaking through to form callus. lthough we focused primarily on changes in gene expression in this paper, future research could further explore how these enzymes contribute to wound healing by regulating protein expression and cell behavior.

Currently, grafting technology is widely used for plant sex selection. Additionally, numerous molecular marker techniques have been developed, providing advantages for plant gender selection. This study demonstrates that grafting, as a relatively traditional method, can effectively improve graft survival rate through the use of E. ulmoides β-1, 4-glucanase. In the future, male and female heterozygous plants can efficiently utilize β-1, 4-glucanase for grafting in breeding programs.

Conclusion

In this study, homologous gene cloning of the gene encoding β-1, 4-glucanase in E. ulmoides was successfully conducted. The protein was expressed using the Pichia pastoris system, and purified β-1, 4-glucanase was obtained through extensive fermentation in vitro. Remarkably, the application of β-1, 4-glucanase significantly enhanced the survival rate of E. ulmoides grafting. These findings have significant implications for the advancement of single-sex breeding and grafting techniques in E. ulmoides.