Introduction

Enterobacter cloacae complex (ECC) is one of the most common pathogens in hospitals and contains the major multi-drug resistant bacterial pathogens, mainly including E. cloacae, E. asburiae, E. hormaechei, E. kobei, E. ludwigii, E. mori, and E. nimipressuralis1. ECC is widely distributed in the environment, animals, and humans, which also poses a huge challenge to effective clinical treatment2,3,4,5. The Enterobacter species/cluster may have different clinical significance6. E. chuandaensis is the ECC first recovered from the blood sample of a patient at West China Hospital, Chengdu, the People’s Republic of China in 20177. Additionally, there have been few global reports on this species. As a newly discovered member of the ECC in recent years, its resistance phenotype and genomic characteristics are still unclear.

Carbapenems, such as meropenem, imipenem, and ertapenem, are typical β-lactam antibiotics with a broad resistance spectrum and have recently been recognized as the last resort for clinical treatment of multi-drug resistant gram-negative bacteria8. Successful expansion of clonal replication and frequent horizontal transfer of carbapenemase genes-bearing plasmids contribute to the increase of carbapenem-resistant Enterobacteriaceae (CRE)9. Due to the limited options of antibiotics, the clinical treatment of CRE infection also faces severe challenges. Notably, carbapenem-resistant Enterobacter cloacae complex (CREC) is among the most common CRE in China10. The high lethality and disability caused by the infection pose a great challenge for clinical treatment. CRE resistance can be induced by carbapenemase, porin, efflux pump, penicillin-binding protein alteration, and biofilm production11. Among them, the increasing prevalence of carbapenemase-producing organisms is particularly concerning given the rapid spread of mobile genetic elements containing carbapenemase genes12. The prevalence of CRE in China is attributed to the dissemination of conservative mobile elements carrying blaNDM or blaKPC−2 on conjugative and non-conjugative plasmids13. It is imperative to further monitor and control the transmission of ECC carrying blaKPC and blaNDM in China, which may be a reservoir of antimicrobial resistance genes.

In China, the proportion of carbapenemase-producing Enterobacter (CP-Ent) in carbapenem-resistant Enterobacter(CR-Ent) was high in comparison to other global regions14. Furthermore, the majority of the CREC strains carried carbapenemase-encoding genes, with blaNDM−1being the most prevalent15. The blaNDM−1-bearing plasmid was strongly related to the antimicrobial agents and biofilm formation, which might be associated with long-term and chronic infections leading to an additional challenge in the treatment of bacterial infections16. Now the reports of CREC strains co-carrying blaNDM−1and other carbapenemase-encoding genes have been gradually common17.

While CREC carrying either blaKPC−2 or blaNDM−1 have been widely identified, CREC with the co-existence of blaKPC−2 and blaNDM−1 have been rarely reported18. Herein, we first report the E. chuandaensis strain harboring blaNDM−1 and two copies of blaKPC−2, suggesting that the carbapenem resistance spectrum may potentially broaden, which is worthy of our attention and further study. Based on this, this study focuses on the resistance characteristics, plasmid features, and potential multi-drug resistant mechanisms in E. chuandaensis.

Results

Multidrug-resistant E. chuandaensis ST2493 isolate from a patient with hospitalizations

FAHZZU5885 was isolated from a perianal swab of a patient admitted to the ICU in the First Affiliated Hospital of Zhengzhou University in 2022. This patient had a history of multiple hospitalizations and resuscitations with the use of meropenem and vancomycin. This strain was identified as E. chuandaensis based on the Matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF-MS) and average nucleotide identity (ANI) analysis, where this strain shared a 98.48% ANI value with the E. chuandaensis reference genome ASM359491v1. Whole-genome sequencing (WGS) revealed that E. chuandaensis FAHZZU5885 belonged to ST2493 (dnaA-fusA-gyrB-leuS-pyrG-rplB-rpoB: 184-433-201-563-277-86-304), which was a novel sequence type first reported in ECC. Twenty-two antibiotics were tested in antimicrobial susceptibility testing (AST), including omadacycline and eravacycline, which are two novel antibacterials within the tetracycline class19. FAHZZU5885 was resistant to most of the tested antibiotics except for amikacin, tigecycline, and colistin (Table 1). This multi-drug-resistant strain posed significant challenges for clinical treatment. The resistance profile of this strain generally aligns with the presence of corresponding resistance genes (Tables 1 and 2).

Table 1 Susceptibility of Enterobacter chuandaensis strain 5885 and transconjugant 5885-J53.
Full size table
Table 2 Features of chromosome and plasmids harbored by FAHZZU5885.
Full size table

The confirmation of two bla KPC−2-bearing plasmids in FAHZZU5885

The genome of E. chuandaensis FAHZZU5885 consisted of one chromosome and three plasmids (Fig. 1C). Among them, the size of the chromosome was 4,872,395 bp with an average GC content of 55.5%. p5885-KPC-1 (127,537 bp), p5885-KPC-2 (85,101 bp), and p5885-NDM (77,383 bp) were identified as three different plasmid groups. According to the Resfinder, resistance genes located on different plasmids were detected (Table 2). WGS confirmed the presence of two blaKPC−2-bearing plasmids, which is in line with the result of S1 nuclease pulsed-field gel electrophoresis (S1-PFGE) and Southern blot (Fig. 1C). Two blaKPC−2 genes were located at ~ 120 kb IncFIA-IncFII plasmid p5885-KPC-1 and ~ 80 kb IncR plasmid p55885-KPC-2, respectively. Significantly, IncR-type plasmid p55885-KPC-2 was the main resistance reservoir, which conferred resistance to aminoglycoside, quinolone, beta-lactam, folate pathway antagonist, macrolide, tetracycline, and rifamycin (Table 2).

Fig. 1
figure 1

The confirmation of two blaKPC−2-bearing plasmids in FAHZZU5885. (A) Circular comparison between p5885-KPC-1 and three similar blaKPC−2-bearing plasmids in NCBI database (98% query coverage and 99% nucleotide identity). p5885-KPC-1 was used as the reference in the outermost ring. (B) Circular comparison between p5885-KPC-2 and three similar blaKPC−2-bearing plasmids in NCBI database (55% query coverage and 99.9% nucleotide identity). p5885-KPC-2 was used as the reference in the outermost ring. (C) Plasmid size determination by S1-PFGE, with Salmonella enterica serotype Braenderup H9812 as the size marker. The ___location of blaKPC−2- and blaNDM−1- harboring plasmids were shown with Southern blotting hybridization with the specific probes.

Full size image

Repeated conjugation experiments with both p5885-KPC-1 and p5885-KPC-2 were unsuccessful. Attempts to transfer the plasmid extracted from the isolate using electroporation methods also failed to convey the plasmid to recipient E. coli DH5α cells. OriTFinder analysis revealed that p5885-KPC-1 and p5885-NDM possess complete conjugative systems. However, p5885-KPC-2, identified with only oriT, lacks essential transfer genes such as type IV secretion system (T4SS) and type IV coupling protein (T4CP). This deficiency may explain the unsuccessful conjugation of p5885-KPC-2 (Figure S1).

Tn3 plays a significant role in disseminating bla KPC−2 genes

In the comparative analysis of the two blaKPC−2-bearing plasmids, we examined their structural and genetic features. The 127,537 bp IncF plasmid p5885-KPC-1 possessed an average GC content of 53.6%. The overall structure of p5885-KPC-1 was most similar to pK518_KPC (CP023186) and pK92-KPC (OL828742) from Klebsiella michiganensis and pBKPC18-1 (CP022275) present in Citrobacter freundii (Fig. 1A). The main differences were concentrated in one gap located downstream of the SOS-regulated proteins umuC and umuD. The second blaKPC−2-bearing plasmid, designated as p5885-KPC-2, was an IncR-type plasmid with a size of 85,101 bp and an average GC content of 54.8% (Fig. 1B). This plasmid was a huge antimicrobial reservoir that cointegrated thirteen antimicrobial resistance genes (ARGs). The most similar structures could be seen in Klebsiella pneumoniae unnamed2 (no. CP058868), unnamed1 (no. CP065348), and pWSZBR (no. CP015991). The backbone of the p5885-KPC-2 that was responsible for plasmid replication and maintenance, such as xerC, stbA, and parA, was certainly the same as the above three plasmids. The difference was the profiles of resistance genes and mobile elements (Fig. 1B). The blaKPC−2 gene was situated within a multidrug resistance region (MRR) containing multiple ARGs and insertion sequence (IS) elements.

Compared with the genetic surroundings of the two blaKPC−2, the core platform in Tn3 (klcA-korC-ISkpn6-blaKPC−2-ISkpn27-tnpR-tnpA) was associated with blaKPC−2 (Fig. 2). This conserved sequence was commonly found in Chinese Enterobacteriaceae strains20. The difference in the genetic surroundings of the two blaKPC−2 lay in the insertion of resistance genes aac(3) and blaTEM−1B downstream of tnpA, followed by transposable elements ISkpn27, Tn3-tnpR, and truncated tnpA, which were similar to the conserved sequence of blaKPC−2. Tn3-based blaKPC−2-carrying transposon was associated with several additional resistance modules, forming a unified multi-drug resistance (MDR) region.

Fig. 2
figure 2

Comparison of genes surrounding blaKPC−2 on p5885-KPC-1, p5885-KPC-2, pK518_KPC (accession no. CP023186), and pWSZBR (accession no. CP15991). Open reading frames (ORFs) are indicated by arrows and are colored according to their presumed function. Grey shading indicates shared regions with a high degree of nucleotide identity. Red indicates antimicrobial resistance genes, yellow indicates genes related to mobile elements, blue represents other functional genes, and grey indicates genes encoding hypothetical proteins as well as proteins with unknown functions.

Full size image

bla NDM−1-bearing IncFII plasmid is a key platform for stable resistance dissemination

S1-PFGE, Southern blot, and WGS showed that blaNDM−1-bearing plasmid p5885-NDM was a 77,383 bp IncFII plasmid, with a GC content of 55.6% (Figs. 1C and 3A). This plasmid carried the blaTEM−1B and blaNDM−1, which can be transferred to E. coli J53. According to the AST, the blaNDM−1-bearing transconjugant FAHZZU5885-J53 exhibited increased resistance mainly to the β-lactam (ceftriaxone, cefotaxime, ceftazidime, cefepime, imipenem, meropenem, and amoxicillin-clavulanic acid) as well as to penicillins (piperacillin/tazobactam) (Table 1). To confirm the stability of p5885-NDM, selected 188 colonies were subjected to PCR validation of blaNDM−1 after 5 days of passage. It was found that the preservation rate was 96.28% (Fig. S2). This phenomenon suggested that this plasmid can stably carry the blaNDM−1 gene in an antibiotic-free environment, providing a robust guarantee for horizontal transmission.

Fig. 3
figure 3

Genomic analyses of blaNDM−1-bearing plasmid. (A) Circular comparison between p5885-NDM and three similar blaNDM−1-bearing plasmids in NCBI database (85% query coverage and 99% nucleotide identity). p5885-NDM was used as the reference in the outermost ring. (B) Comparison of genes surrounding blaNDM−1 on p5885-NDM, pCR-13-36-NDM-1 (accession no. MZ857202), p_dmeb_c388_NDM1 (accession no. CP095673). Grey shading indicates shared regions with a high degree of nucleotide identity. Red indicates antimicrobial resistance genes, yellow indicates genes related to mobile elements, blue represents other functional genes, and grey indicates genes encoding hypothetical proteins as well as proteins with unknown functions.

Full size image

Combined with the result of a BLASTn search, linear alignment of the plasmid genomes suggests that p5885-NDM was similar to three different plasmids from Enterobacter hormaechei, Citrobacter freundii and Citrobacter braakii, namely pCR-13-36-NDM-1 (no. MZ857202), pF4321-KPC (no. CP137180), and pF217-KPC_86k (no. CP136729), respectively (Fig. 3A). This plasmid carried abundant tra modules encoding a primary pilus for conjugation, which may be the reason for easy transmission21. We analyzed the genetic context of blaNDM−1 on this plasmid and found a conservative structural sequence (ISAba125-blaNDM−1-ble-trpF-dsbD-cutA-groS-groL) located downstream of the blaNDM−1 gene (Fig. 3B).

Discussion

ECC is a group of common opportunistic pathogens that may cause a wide range of infections, such as pneumonia, urinary tract infections, and even bloodstream infections22,23. Therefore, it is necessary and urgent to make the anti-infection treatment for ECC in the clinic. During various hospital outbreaks, the ECC exhibited a multidrug-resistant phenotype, including resistance to the last-resort carbapenems24. The blaNDM and blaKPC comprised the principal resistance mechanism of carbapenemase-producing ECC in the hospital, causing a threat to public health25. In this study, we first report the MDR E. chuandaensis strain harboring blaNDM−1 and blaKPC−2, suggesting the appearance of carbapenemase-encoding genes in new species. Owing to the similar genetic contexts of the two blaKPC−2-bearing plasmids, Tn3 plays a significant role in the dissemination of blaKPC−2 and may be the major reason for forming two copies of blaKPC−2 in this strain. The blaNDM−1 gene was stably persistent in the transconjugant after successive passage, suggesting that this IncFII plasmid p5885-NDM provided a robust platform for the transmission of blaNDM−1.

The efficient spread of carbapenemase-encoding genes in new species poses a significant threat to human health, which raises our attention. Horizontal transfer of plasmids is a key factor mediating the dissemination of resistance genes in different species, and the emerging plasmid-encoded carbapenemases are increasingly reported worldwide26. The blaNDM−1 in FAHZZU5885 was transferred to E. coli J53, and the transconjugant mainly exhibited increased resistance to β-lactams. This IncFII plasmid carrying blaNDM−1 was highly stable and could carry the resistance gene continuously in an antibiotic-free environment. The blaNDM−1 was incorporated into plasmids and stably inherited in animal-borne E. coli strains that can be maintained in animal gut microflora even without carbapenem selection pressure27. The efficient and stable dissemination of conjugative IncFII plasmid is extremely worrisome. Notably, there were two blaKPC−2-bearing plasmids with different sizes that could not be conjugated. p5885-KPC-1 was unable to transfer despite having a complete conjugative system. This is similar to plasmid pBKPC18-1 which was isolated from C. freundii 18 -1 in Shifeng River, Zhejiang Province, China28. It may be the reason that tra genes are far away from the primary transcriptional region, impairing the synthesis of primary RNA transcript28. Simultaneously, most very large plasmids are non-mobilizable, with evidence of ongoing domestication into secondary chromosomes29. p5885-KPC-2 is a typical non-conjugative IncR plasmid, which lacks related conjugative genes and relaxase genes30.

In addition to plasmids, other mobile genetic elements, including transposons and ISs, play a major role in the horizontal gene transfer and rapid spread of antimicrobial resistance genes in Enterobacteriaceae31. In this study, we found that two blaKPC−2 genes located on different plasmids had the same genetic context. The blaKPC−2 genes were all incorporated into the Tn3 transposon. In China, nearly all of the blaKPC genes are located in the Tn3-Tn4401 chimera with the gene order of Tn3 transposase, Tn3 resolvase, ISKpn8, blaKPC, ISKpn6-like element, Tn1721 resolvase, and Tn1721transposase genes32. This structure might have the potential to acquire the blaKPC−2 gene. Additionally, a study of Klebsiella pneumoniae carrying both blaNDM−1 and blaKPC−2 by Gao et al. proposed that KPC-2 and NDM-1-coproducing carbapenem-resistant Klebsiella pneumoniae (KPC-2-NDM-1-CRKP) emerged from a KPC-2-CRKP progenitor which acquired another highly transferable blaNDM−1 plasmid later33. In this study, the conjugative blaNDM−1-plasmid may also be acquired later by the progenitor of FAHZZU5885 only carrying blaKPC−2 genes, and the Tn3 transposon played a significant role in acquiring and spreading blaKPC−2 genes.

FAHZZU5885 was a typical MDR strain that was resistant to almost all commonly used antibiotics in the clinic, including the novel antibiotics within the tetracycline class, leaving patients with very limited options. The transconjugant only carrying blaNDM−1 reduced the MIC values for meropenem and imipenem compared with the wild strain, suggesting that the high MIC values for carbapenems in the wild strain were due to the combined interaction of blaKPC−2 and blaNDM−133,34. Notably, the IncR plasmid is an important reservoir of multidrug resistance in Enterobacteriaceae because the conserved IncR backbones include the MDR regions35. The IncR plasmid p5885-KPC-2 contributes to the formation of multidrug resistance in this strain. A further comprehensive investigation is warranted on the spread of blaKPC-harboring IncR plasmid.

To date, the isolation rates of E. chuandaensis in clinics may be greatly underestimated due to the limitations of the techniques in MALDI-TOF MS and the complexity of ECC. Although reports on CREC are relatively common, studies on carbapenem and colistin resistances of specific strains in this complex group have been relatively scarce36,37. In future studies, more investigations into the prevalence, persistence, and dissemination of carbapenemase-encoding genes in ECC are required. Further research is also needed to gain a better understanding of the role the plasmids and other genetic elements play in the persistence and dissemination of antimicrobial resistance genes. The limitation of this study is that due to only one sample being detected, it was not possible to clarify the resistance mechanism and genomic characteristics of E. chuandaensis more objectively.

Conclusion

In summary, to the best of our knowledge, we present the inaugural case of E. chuandaensis co-harboring blaNDM−1 and two blaKPC−2, located on three different plasmids. The IncR plasmid carrying blaKPC−2 is a huge antimicrobial reservoir, which contributes to the antimicrobial phenotypes of this strain. The similarity of the genetic contexts of the two blaKPC−2 implies a crucial role for Tn3 in the propagation of antimicrobial resistance. The stability and persistence of blaNDM−1-bearing plasmid are conducive to the continuous dissemination of blaNDM−1. These findings underscore the urgency and significance of controlling CREC dissemination, necessitating monitoring programs to prevent the emergence and further spread of antibiotic resistance.

Materials and methods

Bacterial isolation, identification, and antimicrobial susceptibility testing

During the routine surveillance of antimicrobial resistance of bacteria from the First Affiliated Hospital of Zhengzhou University, the major carbapenemase-encoding genes (blaKPC, blaNDM, blaOXA−48, blaVIM, and blaIMP) were identified using PCR, as described previously38. The species were identified by MALDI-TOF MS (Bruker Daltonik GmbH, Bremen, Germany) and ANI. We performed ANI analysis using pyani (https://github.com/widdowquinn/pyani)39. The creation of a database of MALDI-TOF reference spectral profiles with a high number of representatives associated with the performant MSI (https://msi.happy-dev.fr/) software enabled substantial improvement in the identification of ECC strains40. AST was conducted using both the agar dilution method and broth microdilution method41. The results were interpreted according to Clinical and Laboratory Standards Institute (CLSI) standards (https://clsi.org), while colistin and tigecycline were interpreted according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) clinical breakpoints (https://www.eucast.org/). The omadacycline and eravacycline were interpreted by Food and Drug Administration (FDA) standards (https://www.fda.gov). E. coli ATCC 25922 was used as a quality control strain.

Location of carbapenemase-encoding genes and plasmid transfer experiments

The number and size of plasmids in E. chuandaensis FAHZZU5885 were determined with the S1-nuclease pulsed field gel electrophoresis (S1-PFGE) method. Plasmid DNA fragments were hybridized with digoxigenin-labeled blaNDM−1 or blaKPC−2 specific probes (blaNDM-F: ATGGAATTGCCCAATATTATGCAC, blaNDM-R: TCAGCGCAGCTTGTCGGC; blaKPC-F: ATGTCACTGTATCGCCGTC, blaKPC-R: TTACTGCCCGTTGACGCC) after being transferred to nylon membranes and detected using DIG High Prime DNA Labeling and Detection Starter KitI (Roche, Mannheim, Germany). The ___location of blaNDM−1 and two blaKPC−2were identified by Southern blotting and hybridization with digoxigenin-labeled specific probes42.

The transferability of the plasmids carrying carbapenemase genes was verified by conjugation experiments using NaN3-resistant E. coli J53 as the recipient and strain FAHZZU5885 as the donor. Donor and recipient strains (5 mL each) were cultured overnight shaking at 37 °C and mixed at a donor-recipient ratio of 3:1. The mixed strains were resuspended in 3 mL LB broth. After overnight incubation at 37℃, it was uniformly applied to Mueller-Hinton agar plates containing 200 mg/L azide and 4 mg/L meropenem. The potential transconjugants were verified by PCR (blaNDM-F: ATGGAATTGCCCAATATTATGCAC, blaNDM-R: TCAGCGCAGCTTGTCGGC; blaKPC-F: ATGTCACTGTATCGCCGTC, blaKPC-R: TTACTGCCCGTTGACGCC) and MALDI-TOF MS43. Plasmid extraction was performed using the QIAGEN Large-Contruct Kit (QIAGEN, Hilden, Germany), and the extracted plasmid was electroporated into E. coliDH5α by voltage shock, as described previously44.

Whole-genome sequencing and in silico analyses

Genomic DNA of FAHZZU5885 was extracted using a QIAGEN DNA purification kit (QIAGEN, Hilden, Germany). The DNA sequencing was performed on the Illumina NovaSeq 6000 (Illumina, San Diego, CA, United States) and the Oxford Nanopore (Oxford Nanopore Technologies, Oxford, United Kingdom) platform. The raw llumina reads were assembled using SPAdes3.10.045, and then the short and long reads were hybrid assembled with Unicycler v0.4.7 to get the complete genome sequence46. Prokka was used to annotate the whole genome (https://proksee.ca/). The OriTFinder online tool (https://tool-mml.sjtu.edu.cn/oriTfinder/oriTfinder.html) was used to determine the origin of transfer site (oriT), gene cluster for bacterial type IV secretion system (T4SS), gene encoding type IV coupling protein (T4CP), and relaxase gene. The antimicrobial resistance genes and replicon types of plasmids were determined with the Center for Genomic Epidemiology (https://genomicepidemiology.org/). Additionally, the transposon and IS were detected using the ISFinder database (https://isfinder.biotoul.fr/about.php). The PubMLST (https://pubmlst.org/) was used to determine the MLST of the strain. Then, the figures about the genetic surroundings of antimicrobial resistance genes were made by Easyfig 2.2.547and the BLAST Ring Image Generator (BRIG) was used to compare different plasmid sequences48. A BLASTN search was performed using plasmids p5885-KPC-1, p5885-KPC-2, and p5885-NDM containing blaKPC−2 or blaNDM−1 as a reference sequence against the NCBI database. The selection criteria for comparison plasmids are the three plasmids with the highest nucleotide identity based on the highest query coverage.

Plasmid stability assay

To assess the stability of the plasmid in a bacterial population, FAHZZU5885-J53 was propagated overnight in 5 mL antibiotic-free LB medium at 37 °C while shaking at 200 rpm. Thousand-fold dilutions of the previous cultures were prepared in a fresh 5-mL LB medium until 5 days passage. Cultures from the last passages were serially diluted in saline, and 30 µL of the dilutions (10−5) was spread on plates containing 4 mg/L meropenem. One hundred eighty eight single colonies were verified by PCR to detect blaNDM49.