Role of transforming growth factor-β1 in regulating adipocyte progenitors

Phuong, Nguyen Quynh; Bilal, Muhammad; Nawaz, Allah; Anh, Le Duc; Memoona; Aslam, Muhammad Rahil; Khalid, Sana; Kado, Tomonobu; Watanabe, Yoshiyuki; Nishimura, Ayumi; Igarashi, Yoshiko; Okabe, Keisuke; Hirabayashi, Kenichi; Yamamoto, Seiji; Nakagawa, Takashi; Mori, Hisashi; Usui, Isao; Fujisaka, Shiho; Hayashi, Ryuji; Tobe, Kazuyuki

doi:10.1038/s41598-024-81917-7

Download PDF

Article
Open access
Published: 17 January 2025

Role of transforming growth factor-β1 in regulating adipocyte progenitors

Nguyen Quynh Phuong^1,2^na1,
Muhammad Bilal^1,3,4^na1,
Allah Nawaz^1,5,
Le Duc Anh¹,
Memoona¹,
Muhammad Rahil Aslam¹,
Sana Khalid⁶,
Tomonobu Kado¹,
Yoshiyuki Watanabe¹,
Ayumi Nishimura^1,7,
Yoshiko Igarashi^1,8,
Keisuke Okabe⁹,
Kenichi Hirabayashi¹⁰,
Seiji Yamamoto¹¹,
Takashi Nakagawa¹²,
Hisashi Mori⁶,
Isao Usui¹³,
Shiho Fujisaka¹,
Ryuji Hayashi² &
…
Kazuyuki Tobe^3,14

Scientific Reports volume 15, Article number: 941 (2025) Cite this article

2505 Accesses
Metrics details

Subjects

Abstract

Adipose tissue (AT) metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. Therein, macrophage and its cytokine are important in controlling tissue homeostasis. Among cytokines, the role of transforming growth factor-β1 (Tgf-β1), a cytokine abundantly expressed in CD206⁺ M2-like macrophage and correlated with the expansion of AT and fibrosis, in AT metabolism, remains unknown. We used CD206CreER^T2; Tgf-β1^f/f mouse model in which the Tgf-β1 gene was conditionally deleted in CD206⁺ M2-like macrophages followed by tamoxifen administration, to investigate the role of the Tgf-β1 gene in glucose and insulin metabolism. Our data demonstrated that lack of CD206⁺ M2-like macrophages derived Tgf-β1 gene improved glucose metabolism and insulin sensitivity by enhancing adipogenesis via hyperplasia. The Tgf-β1 gene, specifically from CD206⁺ M2-like macrophages, deletion stimulated APs’ proliferation and differentiation, leading to the generation of smaller mature adipocytes, therefore enhancing insulin sensitivity and improving glucose metabolism under normal chow conditions. Our study brings a new perspective that Tgf-β1 gene deletion specific from CD206⁺ M2-like macrophage promotes adipocyte hyperplasia, improving glucose homeostasis and insulin sensitivity in the lean state.

TGF-β is insufficient to induce adipocyte state loss without concurrent PPARγ downregulation

Article Open access 21 August 2020

Adipocyte GPX4 protects against inflammation, hepatic insulin resistance and metabolic dysregulation

Article 14 January 2022

TGFBI remodels adipose metabolism by regulating the Notch-1 signaling pathway

Article Open access 01 March 2023

Introduction

Adipose tissue (AT) metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. AT includes adipocytes, a stromal vascular fraction (SVF), and an extracellular matrix. Excess nutrients are associated with an expansion of white adipose tissue (WAT)^1,2,3, leading to AT dysfunction, insulin resistance, type 2 diabetes, and other metabolic disorders^4,5. WAT expands in two ways: adipocyte hypertrophy (increased adipocyte size) or adipocyte hyperplasia (de novo adipogenesis)^6,7. The expansion of adipocytes is closely related to SVF. SVF, which is located in the connective tissue surrounding adipocytes, contains heterogeneous cell populations such as adipocyte progenitors (APs) and immune cells. A large number of APs, which give rise to mature adipocytes with a higher number of smaller adipocytes, preserves AT function and enhances insulin sensitivity^8,9. Epididymal WAT (eWAT), a major visceral WAT depot, has the function of energy storage and expands through cellular hypertrophy, increasing inflammation and inflammatory cytokine and leading to insulin resistance¹⁰. Thus, ameliorating the expansion of eWAT brings a promising therapy for obesity-related disorders.

WAT is a source of adipokines, including immune modulatory cytokines, chemokines, and growth hormones. M1-polarized macrophages provide acute pro-inflammatory effector functions by expressing reactive oxygen species, nitric oxide, and secretion of type-1 cytokines such as TNF-α, IFN-γ, and interleukin 1 beta (IL-1β). Previous studies demonstrated that the upregulation of M1 marker genes such as tumor necrosis factor-alpha (TNFα), C–C motif chemokine receptor (CCR) 2, or CD11c resulted in the development of insulin resistance^11,12,13,14. In contrast, macrophages are activated towards M2 polarization characterized by the relatively high expression of CD206, arginase-1, Mgl1, and IL-10, which are involved in the repair or remodeling of tissues^15,16. A recent study reported that depletion of CD206⁺ M2-like macrophage improves glucose and insulin metabolism⁸. Another study showed that ablation of IL10 secreted from macrophages protects from obesity development¹⁷. However, the role of transforming growth factor-β1 (Tgf-β1), a cytokine abundantly expressed in CD206⁺ M2-like macrophage within AT and correlated with the expansion of AT and fibrosis^18,19,20, in AT metabolism remains unknown.

Precious study reported that Tgf-β signaling induces hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells^21,22, suggesting the essential role of Tgf-β1 in regulating APs to respond with adipocyte expansion. Thus, we hypothesize that deletion of Tgf-β1 gene-specific from CD206⁺ M2-like macrophages might improve glucose metabolism and insulin sensitivity by enhancing adipogenesis via stimulating APs proliferation and differentiation.

Results

The Tgf-β1 gene was successfully deleted in our mouse model

To investigate the role of the Tgf-β1 gene in CD206⁺ M2-like macrophage, we used the mice CD206CreER^T2; Tgf-β1^f/f in which Tgf-β1 gene was conditionally deleted from CD206⁺ M2-like macrophage by tamoxifen (TAM) treatment as schema in Fig. 1A. To investigate the role of the Tgf-β1 gene, 18-week-old mice were administered TAM for 5 consecutive days. After 1 week of recovery, we performed GTT and ITT. Finally, mice were sacrificed at 22 weeks as the schematic protocol described in Fig. 1B. Before and after 5 times TAM treatment, the body weights of both groups were comparable (Supplementary Fig. 1A, B). From 6 to 18 weeks of normal chow diet, both food intake and body weight also showed no significant difference between the two groups (Supplementary Fig. 1C, D). When sacrificed, body weight, eWAT, and inguinal white adipose tissue (iWAT) were also comparable between both groups (Supplementary Fig. 2A–C). To evaluate our mouse model, we examined Tgf-β1 gene expression and found it downregulated significantly in the eWAT whole tissue of Tgf-β1 KO mice (Fig. 1C). For further confirmation, we performed immunohistochemistry stained with anti-CD206 and anti-Tgf-β1. The result revealed that CD206 and Tgf-β1 double-positive expression was reduced significantly in Tgf-β1 KO mice (Fig. 1D, E); however, the circulatory Tgf-β1 remained unchanged (Supplementary Fig. 2D). Collectively, our data confirmed that the Tgf-β1 gene was successfully deleted in CD206⁺ M2-like macrophage in our mouse model.

Deleting the Tgf-β1 gene in CD206⁺ M2-like macrophage improves glucose metabolism and insulin sensitivity

We next investigate whether deleting the Tgf-β1 gene derived from CD206⁺ M2-like macrophage affects glucose and insulin metabolism. As expected, in GTT, we found glucose levels were lower in Tgf-β1 KO mice (Fig. 2A), and the area under the GTT curve was also significantly lower in Tgf-β1 KO mice (Fig. 2B). We also found that ITT was improved in Tgf-β1 KO mice (Fig. 2C, D), suggesting Tgf-β1 KO enhances glucose metabolism and insulin sensitivity. Consistent with this, gene analysis revealed that several metabolically favorable genes’ expressions were upregulated significantly in Tgf-β1 KO mice (Fig. 2E). In addition, we also found that the expression of adipogenesis-related genes was elevated significantly in Tgf-β1 KO mice (Fig. 2F). Moreover, the lipogenesis-related genes (such as Fasn, Acaca, and Srebp1c) and lipolysis-related genes (such as Atgl and Hsl) were also upregulated in Tgf-β1 KO mice (Supplementary Fig. 3A). Insulin signaling-related genes were also upregulated in liver and eWAT, but remained unchanged in skeletal muscle (Supplementary Fig. 3B–D). Collectively, our data demonstrated that Tgf-β1 deletion in CD206⁺ M2-like macrophage improved glucose metabolism and insulin sensitivity in lean state.

Lack of CD206⁺ M2-like macrophage-derived Tgf-β1 gene generates smaller adipocytes

We further aimed to find the mechanism behind the lack of the Tgf-β1 gene to promote glucose and insulin tolerance. Previous studies reported that M1 pro-inflammatory marker genes are involved in insulin resistance^11,12,13. M2 macrophages are reported to maintain homeostasis and adapt to energy surplus conditions^23,24. Thus, we examine whether macrophage remodeling was responsible for the improvement. However, we found no significant difference in M1 and M2 macrophage-related gene expression between both groups (Fig. 3A). We next confirmed the CD206⁺ signal by immunohistochemistry and found that there were no significant differences between both groups (Supplementary Fig. 4), suggesting that there was no macrophage remodeling in response to Tgf-β1 gene deletion under normal chow conditions. Another report demonstrated that hyperplasia was involved in insulin sensitivity^7,8. Our data reported that the adipogenesis marker (C/EBPα, Pparγ) was elevated significantly in Tgf-β1 KO mice (Fig. 2E). We next investigated small adipocyte-related gene expression and found it elevated dramatically in Tgf-β1 KO mice (Fig. 3B). As expected, we found that Tgf-β1 KO increased smaller adipocytes with an elevated number of adipocytes and reduced average adipocyte size (Fig. 3C–E). Collectively, our data demonstrated that deletion of Tgf-β1 in CD206⁺ M2-like macrophage stimulated adipogenesis and generated smaller adipocytes.

CD206⁺ M2-like macrophage-derived Tgf-β1 gene deletion enhanced APs proliferation

APs are the population that gives rise to mature adipocytes. TGF-β signaling was reported to control cell proliferation^25,26,27. Other studies also reported that TGF-β signaling induces hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells^21,22. Therefore, we hypothesize that the APs pool was hibernated by CD206⁺ M2-like macrophage-derived Tgf-β1 gene; thus, Tgf-β1 gene deletion stimulated APs proliferation. We investigated the cell cycle-related genes in SVF of eWAT and found that the expression of mKi-67 and Cyclin d1 were increased significantly (Fig. 4A). Platelet-derived growth factor receptor alpha (PDGFRα) is a marker of APs and preadipocytes that can differentiate into functional adipocytes in vivo^28,29,30. We next isolated PDGFRα⁺ cells using magnetic-activated cell sorting (MACS) (Fig. 4B) from eWAT, then examined cell cycle-related gene expression and found that almost all genes elevated dramatically (Fig. 4C). We next examined immunohistochemistry by staining with anti-Ki-67 and anti-PDGFRα and found that PDGFRα⁺Ki-67⁺DAPI⁺ signals were significantly elevated in Tgf-β1 KO mice (Fig. 4D, E). Our data demonstrated that deletion of the Tgf-β1 gene in CD206⁺ M2-like macrophage stimulated APs proliferation.

Impact of CD206⁺ M2-like macrophage-derived Tgf-β1 gene on APs differentiation

A previous study reported that the TGF-β family inhibits Dpp4+ stem cell-like progenitors from differentiating into Icam1⁺ committed pre-adipocytes^31,32. Thus, we hypothesize that Tgf-β1 also inhibited APs’ differentiation. We examined APs-related gene expression and found that almost all genes were increased significantly in the SVF of Tgf-β1 KO mice (Fig. 5A). We further confirmed the expression of APs-related genes and also found that almost all genes were elevated significantly in Pdgfrα⁺ cells of Tgf-β1 KO mice (Fig. 5B). We next performed flow cytometry using the strategy described in Supplementary Fig. 5. Consistent with our data, we found the significant upregulation of Dpp4 and Icam1 double-positive cells in Tgf-β1 KO mice, suggesting the shifting from stem cell-like progenitors to committed pre-adipocytes, resulting in generating more small adipocytes (Fig. 5C, D). Collectively, our data demonstrated that Tgf-β1 gene deletion stimulated stem cell-like progenitors to differentiate into committed pre-adipocytes, thus generating smaller mature adipocytes, stimulating the expression of metabolically favorable genes, and finally improving glucose metabolism and insulin sensitivity in the lean state.

Discussion

AT metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. These include adipocytes, preadipocytes/APs, endothelial cells, and immune cells. Therein, macrophages have an essential role in regulating homeostasis and AT metabolism. AT macrophages (ATMs) maintain tissue homeostasis by scavenging debris, pathogens, and apoptotic or necrotic cells; this efferocytotic process maintains an anti-inflammatory environment³³. ATMs show highly heterogeneous characteristics and include at least two major populations called the classically activated, or M1-ATMs and alternatively activated, or M2-ATMs³⁴. M1 macrophages are mainly induced by Th1 signaling and express high levels of inflammatory cytokines such as TNFα and IL-6, While M2 macrophages are induced by Th2 signaling and are associated with anti-inflammatory reactions³⁵. Previous reports showed that TNFα, a cytokine released from M1 macrophage, increases phosphorylation of PLIN1, promoting basal lipolysis and thus releasing fatty acids (FAs) into plasma^36,37,38. These FAs activate the JNK pathway to increase releasing pro-inflammatory factors, resulting in insulin resistance³⁹. Another cytokine from the M1 macrophage, IL-6, was also reported to increase insulin resistance by promoting lipolysis^40,41. M2 macrophages, on the other hand, were reported to be involved in maintaining insulin sensitivity through their anti-inflammatory functions^23,24. However, recent reports demonstrated that depletion of CD206⁺ M2-like macrophage or ablation IL10 derived from M2 macrophage leads to improved glucose metabolism and insulin sensitivity^8,17, suggesting that not all M2 macrophages were good. From the current study perspective, our data demonstrated that deletion of the Tgf-β1 gene, a cytokine mainly secreted from CD206⁺ M2-like macrophage, improves glucose and insulin sensitivity without macrophage remodeling.

Previous studies reported that TGF-β signaling was involved in inducing hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells^21,22. In addition, Merrick et al. reported that TGF-β signaling inhibits the differentiation from stem cell-like progenitors APs (Dpp4⁺APs) into committed preadipocytes (Icam1⁺APs)³¹. Consistent with them, our data demonstrated that CD206+ M2-like macrophage-derived Tgf-β1 inhibits proliferation and differentiation into mature adipocytes of APs. By inhibiting the proliferation of APs, they can avoid unnecessary cell division, thus preventing cellular senescence and contributing to preserving the quality of APs and maintaining AT homeostasis. However, when we deleted the Tgf-β1 gene specifically in the M2-like macrophage, the inhibition of APs proliferation and differentiation was released. APs start to proliferate and then differentiate into smaller mature adipocytes, readily taking up free fatty acids and glucose, leading to improved glucose tolerance. Obese conditions bring excess nutrients. Thus, AT expand strongly via hyperplasia or hypertrophy. During HFD, Tgf-β1 is also upregulated in AT and robustly inhibits the proliferation and differentiation of APs, which will promote adipocyte hypertrophy, thus secreting inflammation cytokines, resulting in insulin resistance. There may be another mechanism for how increased Tgf-β1 expression worsens insulin resistance in AT in obese conditions. Moreover, the expression of lipogenesis-related genes (such as Fasn, Acaca, and Srebp1c) or lipolysis-related genes (such as Atgl and Hsl) in eWAT of Tgf-β1KO mice were upregulated compared to control mice in lean state. Taken together, the AT metabolism was improved, followed by the deletion of Tgf-β1-derived from CD206⁺ M2-like macrophages. Tgf-β1 transmits its signal to the nucleus through a transcriptional factor called SMAD^42,43. Roh et al.⁴⁴ reported that the TGF-β activated SMAD repressor complex downregulates Pparγ at the transcriptional level via histone deacetylation after binding to a novel TGF-β inhibitory element and canonical SMAD-binding elements. Agreed with them, we also found that Pparγ, the master regular of adipogenesis^45,46, expression was elevated in response to Tgf-β1 gene deletion, suggesting that Tgf-β1 controls the APs pool via interacting with Pparγ.

In conclusion, our study brings a new perspective that Tgf-β1 gene deletion specific from CD206⁺ M2-like macrophage promotes adipocyte hyperplasia, improving glucose homeostasis under physiological conditions. Tgf-β1 in CD206⁺ M2-like macrophages may play a role in the inhibition of unnecessary cell division and cellular senescence of APs, thereby keeping APs young and maintaining adipose tissue homeostasis in lean mice.

Material and methods

Mice

We generated CD206CreER^T2; Tgf-β1^f/f mice by crossing CD206 CreER^T2 mice and Tgf-β1 flox/flox (Tgf-β1^f/f) as previously described by Nawaz et al.⁴⁷. All animals were housed, 6 mice in one cage, in a room with the temperature (24 \(\pm\) 2 degrees and humidity (55 \(\pm\) 5 percentage) were controlled automatically, and the cycle of light/dark was maintained at 12:12 h. The mice had free access to water ad libitum and food (a normal chow diet: CE-2 CLEA, Japan). The mice tissues were collected after euthanizing the mice. The mice were first anesthetized by sevoflurane (Nikko Pharmaceuticals Co., Ltd.) and then followed by cervical dislocation. All the experiments were performed in accordance with the relevant guidelines and regulations and were approved by the Committee for Institutional Animal Care and Use of the University of Toyama (Toyama, Japan).

Genotyping

Whole genomic DNA was obtained by lysis tail tissue with Direct PCR (Tail) lysis solution (Viagen Biotech) and proteinase K (Roche Diagnostics), following the manufacturer’s instructions. We performed PCR by using a Tks Gflex DNA polymerase kit from TAKARA (Shiga, Japan) with this crude DNA.

PCR conditions for CD206 CreER^T2 included segment 1: 1 cycle of 94 degrees for 1 min, segment 2: 30 cycle includes 98 degrees for 10 s; 58 degrees for 30 s; and 68 degrees for 30 s. Then PCR productions were kept at 4 degrees. The expected DNA fragment size is 299 bp. The primers used for PCR had the sequence GGTCGATGCAACGAGTGATGAG (primer 1) and GTGAAACAGCATTGCTGTCACTTGG (primer 2).

The PCR condition for Tgf-β1^f/f included segment 1: 1 cycle of 94 degrees for 1 min, segment 2: 40 cycle including 98 degrees for 10 s; 54 degrees for 30 s; and 68 degrees for 30 s. Then PCR productions were kept at 4 degrees. The expected DNA fragment sizes of WT and f/f mice were 210 bp and 338 bp, respectively. The primers’ sequences were AAGACCTGGGTTGGAAGTG (primer 1) and CTTCTCCGTTTCTCTGTCACCCTAT (primer 2). Both primers for PCR were purchased from Invitrogen™ Life Technology (Tokyo, Japan). Then PCR products were separated using 1.5% Agarose gel (Nippon gel) electrophoresis for 30 min. Ethidium bromide (1:1000) was added to visualize DNA on the gel.

Tamoxifen administration

We used sunflower oil (WAKO) to dissolve tamoxifen (TAM: sigma-Aldrich) incubated at 55 degrees and vortexed every 5 min until dissolved. After dissolved, TAM was administered to both Tgf-β1^f/f and Tgf-β1 KO at the dose of 225 mg/kg body weight for five consecutive days, as previously described¹⁰ at the 18-week-old following schematic protocol in Fig. 1B.

Glucose tolerance and insulin tolerance test

For the intraperitoneal glucose tolerance test (ip-GTT), the mice were fasted for 5 h. Glucose was injected into both Tgf-β1 KO and Tgf- β1^f/f at a dose of 1 mg/g body weight. The blood glucose level was measured at 0, 15, 30, 60, 90 and 120 min. For the intraperitoneal insulin tolerance test (ip- ITT), mice were fasting for 4 h. Both Tgf-β1 KO and Tgf- β1^f/f mice were injected with human insulin (Humalin R) with a dose of 0.8 units/Kg. The blood glucose level was measured at 0, 15, 30, 45, 60, 90, and 120 min. In both ip-GTT and ip-ITT, the blood glucose level was taken from the tail vein using the STAT STRIP Express 900 (Nova Biomedical, Waltham, MA).

Real-time polymerase chain reaction (RT-PCR)

eWAT whole tissue was collected and extracted using the Qiagen RNeasy kit following the manufacturer’s instructions. The TaKaRa PrimerScript RNA Kit was used following the company’s guidance for reverse transcription. The quantitative PCR amplification reaction was performed using gene-specific primers (provided in Supplementary Table S2) and TB Green Fast Premix (Takara, Shiga Japan), followed by the manufacturer’s instructions. The relative mRNA expression levels were calculated by \(\Delta \Delta\) Ct value and normalized by internal control TF2B or RPL13a.

Flow cytometry analysis

To isolate and prepare stromal vascular fraction (SVF) of eWAT^48,49. Tissue was collected and digested in collagenase (Sigma) for 45 min at 37 degrees before filtering through a 100- µm strainer to harvest a single cell. The 7AAD⁻ population was gated to analyze lineage-negative (CD31⁻CD45⁻) populations, followed by Sca1⁺, then separated into Dpp4⁺, Icam1⁺, and Dpp4⁺ Icam1⁺ populations. For justification of the gating strategy, unstained and fluorescence minus one (FMO) were used. All this experiment and cell sorting were performed using BD FACS Aria™ SORP II machine and the FlowJo offline software (v10) to analyze data.

Magnetic-activated cell sorting study

SVF was dissociated from eWAT tissue as previously described^8,48. The SVF was processed for magnetic cell sorting with anti-Pdgfr\(\alpha\) microbeads, then we collected a positive population, extracted RNA, and performed qPCR analysis of adipocyte progenitors and cell cycle. All incubation and procedure were performed at 4 degrees for 10–15 min following the manufacturer’s instructions. Microbead Kit was purchased from Miltenyi Biotech.

Histology

After collection, tissue was fixed in 4%PFA, and paraffin sections were prepared with 5–10 µm thickness and then mounted on the slide.

For Hematoxylin and Eosin (H/E staining), the slide was stained with hematoxylin and eosin. Hematoxylin eosin was captured using Keyence BZ-X800 with a 20× lens (scale bar 200 µm).

Immunohistochemistry

After collection, tissue was fixed in 4%PFA, and paraffin sections were prepared with 5–10 µm thickness and then mounted on the slide. As described previously, paraffin-embedded tissue sections were used in immunohistochemical staining. The primary and secondary antibodies are used following the manufacturer’s instructions, with the ratio for primary antibody being 1:100, the secondary antibody being 1:250, and DAPI being 1:400. Primary antibodies included CD206, Tgf-β1, PDGFRα, and mKi-67. Secondary antibodies included anti-rabbit, anti-mouse, and anti-goat. All primer sources were provided in Supplementary Table S1. All images were taken by an LSM 900 with an Arycan confocal microscope.

Quantification of adipocyte size

The number of adipocytes was counted at 3.9 × 10⁵ µm² (area). The multi-point tool in ImageJ 1.53a (National Institute of Health, USA) was used for adipocyte counting. The “Set Scale” function in ImageJ adipocyte size was used to analyze adipocyte size manually. We measured 4 random fields/specimens, with 4 specimens in each group.

Statistical analysis

Statistical significance between the Tgf-β1 KO and Tgf-β1^f/f group was performed using two-way ANOVA followed by the Sidak multiple comparison test for GTT and ITT. Other data used two-tail unpaired Student’s t-test, *p < 0.05, ** p < 0.01, ***p < 0.001, ****p < 0.0001. Data are expressed as mean ± SEM.

Data availability

The raw data generated for all figures and supplementary figures of this study are provided in the Source data file.

References

Blüher, M. Obesity: global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 15, 288–298. https://doi.org/10.1038/s41574-019-0176-8 (2019).
Article PubMed MATH Google Scholar
Sakers, A., De Siqueira, M. K., Seale, P. & Villanueva, C. J. Adipose-tissue plasticity in health and disease. Cell 185, 419–446. https://doi.org/10.1016/j.cell.2021.12.016 (2022).
Article CAS PubMed PubMed Central MATH Google Scholar
Kahn, C. R., Wang, G. & Lee, K. Y. Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome. J. Clin. Invest. 129, 3990–4000. https://doi.org/10.1172/jci129187 (2019).
Article PubMed PubMed Central MATH Google Scholar
Sun, K., Kusminski, C. M. & Scherer, P. E. Adipose tissue remodeling and obesity. J. Clin. Invest. 121, 2094–2101. https://doi.org/10.1172/jci45887 (2011).
Article CAS PubMed PubMed Central MATH Google Scholar
Klein, S., Gastaldelli, A., Yki-Järvinen, H. & Scherer, P. E. Why does obesity cause diabetes?. Cell Metab. 34, 11–20. https://doi.org/10.1016/j.cmet.2021.12.012 (2022).
Article CAS PubMed PubMed Central Google Scholar
Wang, Q. A., Tao, C., Gupta, R. K. & Scherer, P. E. Tracking adipogenesis during white adipose tissue development, expansion and regeneration. Nat. Med. 19, 1338–1344. https://doi.org/10.1038/nm.3324 (2013).
Article CAS PubMed PubMed Central Google Scholar
Ghaben, A. L. & Scherer, P. E. Adipogenesis and metabolic health. Nat. Rev. Mol. Cell Biol. 20, 242–258. https://doi.org/10.1038/s41580-018-0093-z (2019).
Article CAS PubMed MATH Google Scholar
Nawaz, A. et al. CD206(+) M2-like macrophages regulate systemic glucose metabolism by inhibiting proliferation of adipocyte progenitors. Nat. Commun. 8, 286. https://doi.org/10.1038/s41467-017-00231-1 (2017).
Article ADS CAS PubMed PubMed Central MATH Google Scholar
Joe, A. W., Yi, L., Even, Y., Vogl, A. W. & Rossi, F. M. Depot-specific differences in adipogenic progenitor abundance and proliferative response to high-fat diet. Stem Cells 27, 2563–2570. https://doi.org/10.1002/stem.190 (2009).
Article CAS PubMed Google Scholar
Bilal, M. et al. Fate of adipocyte progenitors during adipogenesis in mice fed a high-fat diet. Mol. Metab. 54, 101328. https://doi.org/10.1016/j.molmet.2021.101328 (2021).
Article CAS PubMed PubMed Central MATH Google Scholar
Uysal, K. T., Wiesbrock, S. M., Marino, M. W. & Hotamisligil, G. S. Protection from obesity-induced insulin resistance in mice lacking TNF-alpha function. Nature 389, 610–614. https://doi.org/10.1038/39335 (1997).
Article ADS CAS PubMed Google Scholar
Weisberg, S. P. et al. CCR2 modulates inflammatory and metabolic effects of high-fat feeding. J. Clin. Invest. 116, 115–124. https://doi.org/10.1172/jci24335 (2006).
Article CAS PubMed MATH Google Scholar
Patsouris, D. et al. Ablation of CD11c-positive cells normalizes insulin sensitivity in obese insulin resistant animals. Cell Metab. 8, 301–309. https://doi.org/10.1016/j.cmet.2008.08.015 (2008).
Article CAS PubMed PubMed Central MATH Google Scholar
Kamei, N. et al. Overexpression of monocyte chemoattractant protein-1 in adipose tissues causes macrophage recruitment and insulin resistance. J. Biol. Chem. 281, 26602–26614. https://doi.org/10.1074/jbc.M601284200 (2006).
Article CAS PubMed MATH Google Scholar
Lumeng, C. N., Bodzin, J. L. & Saltiel, A. R. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J. Clin. Invest. 117, 175–184. https://doi.org/10.1172/jci29881 (2007).
Article CAS PubMed PubMed Central Google Scholar
Lumeng, C. N., DelProposto, J. B., Westcott, D. J. & Saltiel, A. R. Phenotypic switching of adipose tissue macrophages with obesity is generated by spatiotemporal differences in macrophage subtypes. Diabetes 57, 3239–3246. https://doi.org/10.2337/db08-0872 (2008).
Article CAS PubMed PubMed Central Google Scholar
Rajbhandari, P. et al. IL-10 signaling remodels adipose chromatin architecture to limit thermogenesis and energy expenditure. Cell 172, 218-233.e217. https://doi.org/10.1016/j.cell.2017.11.019 (2018).
Article CAS PubMed MATH Google Scholar
Meng, X. M., Nikolic-Paterson, D. J. & Lan, H. Y. TGF-β: the master regulator of fibrosis. Nat. Rev. Nephrol. 12, 325–338. https://doi.org/10.1038/nrneph.2016.48 (2016).
Article CAS PubMed Google Scholar
Samad, F. et al. Tumor necrosis factor alpha is a key component in the obesity-linked elevation of plasminogen activator inhibitor 1. Proc. Natl. Acad. Sci. U. S. A. 96, 6902–6907. https://doi.org/10.1073/pnas.96.12.6902 (1999).
Article ADS CAS PubMed PubMed Central MATH Google Scholar
Samad, F., Yamamoto, K., Pandey, M. & Loskutoff, D. J. Elevated expression of transforming growth factor-beta in adipose tissue from obese mice. Mol. Med. 3, 37–48 (1997).
Article CAS PubMed PubMed Central Google Scholar
Yamazaki, S. et al. Nonmyelinating Schwann cells maintain hematopoietic stem cell hibernation in the bone marrow niche. Cell 147, 1146–1158. https://doi.org/10.1016/j.cell.2011.09.053 (2011).
Article CAS PubMed MATH Google Scholar
Nishimura, E. K. et al. Key roles for transforming growth factor beta in melanocyte stem cell maintenance. Cell Stem Cell 6, 130–140. https://doi.org/10.1016/j.stem.2009.12.010 (2010).
Article CAS PubMed PubMed Central MATH Google Scholar
Lumeng, C. N. & Saltiel, A. R. Inflammatory links between obesity and metabolic disease. J. Clin. Invest. 121, 2111–2117. https://doi.org/10.1172/jci57132 (2011).
Article CAS PubMed PubMed Central MATH Google Scholar
Pollard, J. W. Trophic macrophages in development and disease. Nat. Rev. Immunol. 9, 259–270. https://doi.org/10.1038/nri2528 (2009).
Article CAS PubMed PubMed Central MATH Google Scholar
Huang, S. S. & Huang, J. S. TGF-beta control of cell proliferation. J. Cell Biochem. 96, 447–462. https://doi.org/10.1002/jcb.20558 (2005).
Article CAS PubMed MATH Google Scholar
Zhang, Y., Alexander, P. B. & Wang, X. F. TGF-β Family signaling in the control of cell proliferation and survival. Cold Spring Harb. Perspect. Biol. 9, 78. https://doi.org/10.1101/cshperspect.a022145 (2017).
Moustakas, A., Pardali, K., Gaal, A. & Heldin, C. H. Mechanisms of TGF-beta signaling in regulation of cell growth and differentiation. Immunol. Lett. 82, 85–91. https://doi.org/10.1016/s0165-2478(02)00023-8 (2002).
Article CAS PubMed MATH Google Scholar
Feng, X. H. & Derynck, R. Specificity and versatility in tgf-beta signaling through Smads. Annu. Rev. Cell Dev. Biol. 21, 659–693. https://doi.org/10.1146/annurev.cellbio.21.022404.142018 (2005).
Article CAS PubMed MATH Google Scholar
Iwayama, T. et al. PDGFRα signaling drives adipose tissue fibrosis by targeting progenitor cell plasticity. Genes Dev. 29, 1106–1119. https://doi.org/10.1101/gad.260554.115 (2015).
Article CAS PubMed PubMed Central MATH Google Scholar
Lee, Y. H., Petkova, A. P., Mottillo, E. P. & Granneman, J. G. In vivo identification of bipotential adipocyte progenitors recruited by β3-adrenoceptor activation and high-fat feeding. Cell Metab. 15, 480–491. https://doi.org/10.1016/j.cmet.2012.03.009 (2012).
Article CAS PubMed PubMed Central Google Scholar
Merrick, D. et al. Identification of a mesenchymal progenitor cell hierarchy in adipose tissue. Science 364, 859. https://doi.org/10.1126/science.aav2501 (2019).
Ignotz, R. A. & Massagué, J. Type beta transforming growth factor controls the adipogenic differentiation of 3T3 fibroblasts. Proc. Natl. Acad. Sci. U. S. A. 82, 8530–8534. https://doi.org/10.1073/pnas.82.24.8530 (1985).
Article ADS CAS PubMed PubMed Central MATH Google Scholar
Fischer-Posovszky, P., Wang, Q. A., Asterholm, I. W., Rutkowski, J. M. & Scherer, P. E. Targeted deletion of adipocytes by apoptosis leads to adipose tissue recruitment of alternatively activated M2 macrophages. Endocrinology 152, 3074–3081. https://doi.org/10.1210/en.2011-1031 (2011).
Article CAS PubMed PubMed Central Google Scholar
Mantovani, A. et al. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 25, 677–686. https://doi.org/10.1016/j.it.2004.09.015 (2004).
Article CAS PubMed MATH Google Scholar
Fujisaka, S. The role of adipose tissue M1/M2 macrophages in type 2 diabetes mellitus. Diabetol. Int. 12, 74–79. https://doi.org/10.1007/s13340-020-00482-2 (2021).
Article PubMed MATH Google Scholar
Yang, X., Zhang, X., Heckmann, B. L., Lu, X. & Liu, J. Relative contribution of adipose triglyceride lipase and hormone-sensitive lipase to tumor necrosis factor-α (TNF-α)-induced lipolysis in adipocytes. J. Biol. Chem. 286, 40477–40485. https://doi.org/10.1074/jbc.M111.257923 (2011).
Article CAS PubMed PubMed Central Google Scholar
Langin, D. & Arner, P. Importance of TNFalpha and neutral lipases in human adipose tissue lipolysis. Trends Endocrinol. Metab. 17, 314–320. https://doi.org/10.1016/j.tem.2006.08.003 (2006).
Article CAS PubMed MATH Google Scholar
Rydén, M. & Arner, P. Tumour necrosis factor-alpha in human adipose tissue—from signalling mechanisms to clinical implications. J. Intern. Med. 262, 431–438. https://doi.org/10.1111/j.1365-2796.2007.01854.x (2007).
Article CAS PubMed MATH Google Scholar
Nguyen, M. T. et al. A subpopulation of macrophages infiltrates hypertrophic adipose tissue and is activated by free fatty acids via Toll-like receptors 2 and 4 and JNK-dependent pathways. J. Biol. Chem. 282, 35279–35292. https://doi.org/10.1074/jbc.M706762200 (2007).
Article CAS PubMed Google Scholar
Weisberg, S. P. et al. Obesity is associated with macrophage accumulation in adipose tissue. J. Clin. Invest. 112, 1796–1808. https://doi.org/10.1172/jci19246 (2003).
Article CAS PubMed PubMed Central MATH Google Scholar
Perry, R. J. et al. Hepatic acetyl CoA links adipose tissue inflammation to hepatic insulin resistance and type 2 diabetes. Cell 160, 745–758. https://doi.org/10.1016/j.cell.2015.01.012 (2015).
Article CAS PubMed PubMed Central MATH Google Scholar
Shi, Y. & Massagué, J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113, 685–700. https://doi.org/10.1016/s0092-8674(03)00432-x (2003).
Article CAS PubMed MATH Google Scholar
Massagué, J. & Sheppard, D. TGF-β signaling in health and disease. Cell 186, 4007–4037. https://doi.org/10.1016/j.cell.2023.07.036 (2023).
Article CAS PubMed PubMed Central MATH Google Scholar
Roh, H. C. et al. Adipocytes fail to maintain cellular identity during obesity due to reduced PPARγ activity and elevated TGFβ-SMAD signaling. Mol. Metab. 42, 101086. https://doi.org/10.1016/j.molmet.2020.101086 (2020).
Article CAS PubMed PubMed Central MATH Google Scholar
Lefterova, M. I., Haakonsson, A. K., Lazar, M. A. & Mandrup, S. PPARγ and the global map of adipogenesis and beyond. Trends Endocrinol. Metab. 25, 293–302. https://doi.org/10.1016/j.tem.2014.04.001 (2014).
Article CAS PubMed PubMed Central Google Scholar
Mota de Sá, P., Richard, A. J., Hang, H. & Stephens, J. M. Transcriptional regulation of adipogenesis. Compr. Physiol. 7, 635–674. https://doi.org/10.1002/cphy.c160022 (2017)
Nawaz, A. et al. Depletion of CD206(+) M2-like macrophages induces fibro-adipogenic progenitors activation and muscle regeneration. Nat. Commun. 13, 7058. https://doi.org/10.1038/s41467-022-34191-y (2022).
Article ADS CAS PubMed PubMed Central MATH Google Scholar
Takikawa, A. et al. HIF-1α in myeloid cells promotes adipose tissue remodeling toward insulin resistance. Diabetes 65, 3649–3659. https://doi.org/10.2337/db16-0012 (2016).
Article CAS PubMed MATH Google Scholar
Fujisaka, S. et al. Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice. Diabetes 58, 2574–2582. https://doi.org/10.2337/db08-1475 (2009).
Article CAS PubMed PubMed Central MATH Google Scholar

Download references

Acknowledgements

This research was supported by Moonshot R&D (Grant numbers JPMJMS2021). This study was also supported by Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS) (24K02502 to K. T, 22K203737 and 24K19282 to M.B, 21K16338 and 23KJ1022 to Y.I, 22K16423 and 24K19303 to A.Nishimura, 22K16424 to Y.W.). Research Grants from The Uehara Memorial Foundation 2023 to K.T, Eli Lilly Japan KK Innovation Research Grant 2023 to K.T., and a grant from Suzuken Memorial Foundation to M.B. This work was also supported by the Young Research Grant from the Japan Diabetes Society (to A.N., T.K. and A. Nishimura), and a grant from the Japan Foundation for Applied Enzymology (a grant for Front Runner of Future Diabetes Research to M.B., A.N. and T.K.). This work was also supported by Grant from The Naito Foundation (2021-2023) to Y.I., Japan Diabetes Foundation to S.F., T.K. and A. Nishimura, Japan Society for the Study of Obesity (JASSO) to S.F., First Bank of Toyama Scholarship Foundation to S. F., Yamaguchi Endocrine Research Foundation to S.F., Japan Association for Diabetes Education and Care to S.F., a grant from Boehringer Ingelheim to T.K., a grant from Novo Nordisk Pharma to A. Nishimura., a grant from Lotte Foundation to Y.W., Hokugin Young Researchers Grant to Y.W., ONO Medical Research Foundation to T.K., and a grant for Young Researchers from Japan Association for Diabetes Education and Care to T.K.

Author information

These authors contributed equally: Nguyen Quynh Phuong and Muhammad Bilal.

Authors and Affiliations

First Department of Internal Medicine, Faculty of Medicine, University of Toyama, 2630 Sugitani, Toyama, 930-0194, Japan
Nguyen Quynh Phuong, Muhammad Bilal, Allah Nawaz, Le Duc Anh, Memoona, Muhammad Rahil Aslam, Tomonobu Kado, Yoshiyuki Watanabe, Ayumi Nishimura, Yoshiko Igarashi & Shiho Fujisaka
Clinical Oncology, Faculty of Medicine, University of Toyama, Toyama, 930-0194, Japan
Nguyen Quynh Phuong & Ryuji Hayashi
Research Center for Pre-Disease Science, Faculty of Education and Research Promotion, University of Toyama, Toyama, 930-0194, Japan
Muhammad Bilal & Kazuyuki Tobe
Advanced Postdoctoral Fellowships of the Japan Diabetes Society (JDS), Tokyo, Japan
Muhammad Bilal
Section of Integrative Physiology and Metabolism, Joslin Diabetes Center, Harvard Medical School, Boston, MA, USA
Allah Nawaz
Department of Molecular Neuroscience, Faculty of Medicine, University of Toyama, Toyama, 930-0194, Japan
Sana Khalid & Hisashi Mori
Faculty of Education and Research Promotion, University of Toyama, Toyama, 930-0194, Japan
Ayumi Nishimura
JSPS Research Fellowship for Young Scientist Japan, Tokyo, Japan
Yoshiko Igarashi
Toyama University Hospital, Center for Clinical and Translational Research, Toyama, Japan
Keisuke Okabe
Department of Diagnostic Pathology, Faculty of Medicine, University of Toyama, Toyama, 930-0194, Japan
Kenichi Hirabayashi
Department of Pathology, Faculty of Medicine, University of Toyama, Toyama, 930-0194, Japan
Seiji Yamamoto
Department of Molecular and Medical Pharmacology, Faculty of Medicine, University of Toyama, Toyama, 930-0194, Japan
Takashi Nakagawa
Department of Endocrinology and Metabolism, Dokkyo Medical University, Tochigi, Japan
Isao Usui
Faculty of Medicine, University of Toyama, Toyama, 930-0194, Japan
Kazuyuki Tobe

Authors

Nguyen Quynh Phuong
View author publications
Search author on:PubMed Google Scholar
Muhammad Bilal
View author publications
Search author on:PubMed Google Scholar
Allah Nawaz
View author publications
Search author on:PubMed Google Scholar
Le Duc Anh
View author publications
Search author on:PubMed Google Scholar
Memoona
View author publications
Search author on:PubMed Google Scholar
Muhammad Rahil Aslam
View author publications
Search author on:PubMed Google Scholar
Sana Khalid
View author publications
Search author on:PubMed Google Scholar
Tomonobu Kado
View author publications
Search author on:PubMed Google Scholar
Yoshiyuki Watanabe
View author publications
Search author on:PubMed Google Scholar
Ayumi Nishimura
View author publications
Search author on:PubMed Google Scholar
Yoshiko Igarashi
View author publications
Search author on:PubMed Google Scholar
Keisuke Okabe
View author publications
Search author on:PubMed Google Scholar
Kenichi Hirabayashi
View author publications
Search author on:PubMed Google Scholar
Seiji Yamamoto
View author publications
Search author on:PubMed Google Scholar
Takashi Nakagawa
View author publications
Search author on:PubMed Google Scholar
Hisashi Mori
View author publications
Search author on:PubMed Google Scholar
Isao Usui
View author publications
Search author on:PubMed Google Scholar
Shiho Fujisaka
View author publications
Search author on:PubMed Google Scholar
Ryuji Hayashi
View author publications
Search author on:PubMed Google Scholar
Kazuyuki Tobe
View author publications
Search author on:PubMed Google Scholar

Contributions

N.Q.P and M.B. contributed equally, performed all experiments, acquired the data, and wrote the manuscript. M.B., A.N., and K.T. generate the hypothesis. T.K., Y.I., and H.M., generated mice. M.M., S.K., L.D.A., M.R.A., Ay.N. Y.W., Y.I. helped perform genotype and RT-qPCR analysis. K.O., A.N., I.U., and S.F. helped with manuscript writing. S.Y., K.H., help in performing histology. T.N, H.M. and R.H. helped in the discussion. K.T. supervised the project.

Corresponding authors

Correspondence to Muhammad Bilal or Kazuyuki Tobe.

Ethics declarations

Competing interests

The authors declare no competing interests.

Ethical approval

All procedures were conducted in accordance with ARRIVE guidelines. All experiments and procedures were performed in accordance with the relevant guidelines and regulations and were approved by the Animal Care Committee of the University of Toyama (Approved number A2023MED-16).

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary Information 1.

Supplementary Information 2.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Phuong, N.Q., Bilal, M., Nawaz, A. et al. Role of transforming growth factor-β1 in regulating adipocyte progenitors. Sci Rep 15, 941 (2025). https://doi.org/10.1038/s41598-024-81917-7

Download citation

Received: 02 July 2024
Accepted: 29 November 2024
Published: 17 January 2025
DOI: https://doi.org/10.1038/s41598-024-81917-7