Abstract
The methyltransferase complex (MTC) deposits N6-adenosine (m6A) onto RNA, whereas the microprocessor produces microRNA. Whether and how these two distinct complexes cross-regulate each other has been poorly studied. Here we report that the MTC subunit B tends to form insoluble condensates with poor activity, with its level monitored by the 20S proteasome. Conversely, the microprocessor component SERRATE (SE) forms liquid-like condensates, which in turn promote the solubility and stability of the MTC subunit B, leading to increased MTC activity. Consistently, the hypomorphic lines expressing SE variants, defective in MTC interaction or liquid-like phase behaviour, exhibit reduced m6A levels. Reciprocally, MTC can recruit the microprocessor to the MIRNA loci, prompting co-transcriptional cleavage of primary miRNA substrates. Additionally, primary miRNA substrates carrying m6A modifications at their single-stranded basal regions are enriched by m6A readers, which retain the microprocessor in the nucleoplasm for continuing processing. This reveals an unappreciated mechanism of phase separation in RNA modification and processing through MTC and microprocessor coordination.
This is a preview of subscription content, access via your institution
Access options
Access Nature and 54 other Nature Portfolio journals
Get Nature+, our best-value online-access subscription
27,99 € / 30 days
cancel any time
Subscribe to this journal
Receive 12 print issues and online access
209,00 € per year
only 17,42 € per issue
Buy this article
- Purchase on SpringerLink
- Instant access to full article PDF
Prices may be subject to local taxes which are calculated during checkout
Similar content being viewed by others
Data availability
All data are available in the main text or the supplementary materials. High-throughput sequencing data generated by this study can be accessed in the National Center for Biotechnology Information BioProject database under accession code PRJNA1102430. SE ChIP-seq data can be accessed in the European Nucleotide Archive under accession number ERP016859 (ref. 37). The MTA sRNA-seq data published in previous study can be accessed in the the National Center for Biotechnology Information Gene Expression Omnibus database under accession code GSE122528 (ref. 23). For pan-transcriptome analysis, data were downloaded from an Arabidopsis RNA-seq database, a comprehensive online repository housing over 20,000 publicly available Arabidopsis RNA-seq libraries (http://ipf.sustech.edu.cn/pub/athrna/)26 and the accession codes include DRX065024,DRX065025, DRX065030 (root), DRX066825, DRX092558, DRX092559 (leaf), DRX014760, DRX014761, DRX084079 (seedling), DRX066823, DRX066824, DRX066832 (shoot), GSM1501691, GSM1501692, GSM1694242 (stem), SRX822029, SRX822030, GSM1855883 (meristem), ERX1512314, ERX1512315, ERX1512316 (flower), ERX1719913, ERX1719914, ERX1719915 (seed), GSM1276497, GSM1276499, GSM1276501(embryo), and GSM1276498, GSM1276500, GSM1276502 (endosperm), which are also provided in the Supplementary Table 1. Genetic materials will be available when requested. Source data are provided with this paper.
Code availability
This paper does not report original code.
References
Alberti, S. & Hyman, A. A. Biomolecular condensates at the nexus of cellular stress, protein aggregation disease and ageing. Nat. Rev. Mol. Cell Biol. 22, 196–213 (2021).
Li, P. B. et al. Phase transitions in the assembly of multivalent signalling proteins. Nature 483, 336–340 (2012).
Peeples, W. & Rosen, M. K. Mechanistic dissection of increased enzymatic rate in a phase-separated compartment. Nat. Chem. Biol. 17, 693–702 (2021).
Chong, S. et al. Imaging dynamic and selective low-complexity ___domain interactions that control gene transcription. Science 361, eaar2555 (2018).
Wei, M. T. et al. Nucleated transcriptional condensates amplify gene expression. Nat. Cell Biol. 22, 1187–1196 (2020).
Xie, D. et al. Phase separation of SERRATE drives dicing body assembly and promotes miRNA processing in Arabidopsis. Nat. Cell Biol. 23, 32–39 (2021).
Shin, Y. & Brangwynne, C. P. Liquid phase condensation in cell physiology and disease. Science 357, eaaf4382 (2017).
Banani, S. F., Lee, H. O., Hyman, A. A. & Rosen, M. K. Biomolecular condensates: organizers of cellular biochemistry. Nat. Rev. Mol. Cell Biol. 18, 285–298 (2017).
Kato, M. & McKnight, S. L. A solid-state conceptualization of information transfer from gene to message to protein. Annu. Rev. Biochem. 87, 351–390 (2018).
Kumar Deshmukh, F., Yaffe, D., Olshina, M. A., Ben-Nissan, G. & Sharon, M. The contribution of the 20S proteasome to proteostasis. Biomolecules 9, 190 (2019).
Shang, B., Li, C. & Zhang, X. How intrinsically disordered proteins order plant gene silencing. Trends Genet. 40, 260–275 (2024).
Emenecker, R. J., Holehouse, A. S. & Strader, L. C. Emerging roles for phase separation in plants. Dev. Cell 55, 69–83 (2020).
Jozwiak, M., Bielewicz, D., Szweykowska-Kulinska, Z., Jarmolowski, A. & Bajczyk, M. SERRATE: a key factor in coordinated RNA processing in plants. Trends Plant Sci. https://doi.org/10.1016/j.tplants.2023.03.009 (2023).
Li, Q. et al. DEAD-box helicases modulate dicing body formation in Arabidopsis. Sci. Adv. 7, eabc6266 (2021).
Shang, B. et al. Intrinsically disordered proteins SAID1/2 condensate on SERRATE for dual inhibition of miRNA biogenesis in Arabidopsis. Proc. Natl Acad. Sci. USA 120, e2216006120 (2023).
Li, Y. et al. Degradation of SERRATE via ubiquitin-independent 20S proteasome to survey RNA metabolism. Nat. Plants 6, 970–982 (2020).
Wang, L. et al. PRP4KA phosphorylates SERRATE for degradation via 20S proteasome to fine-tune miRNA production in Arabidopsis. Sci. Adv. 8, eabm8435 (2022).
Han, D. et al. Dynamic assembly of the mRNA m6A methyltransferase complex is regulated by METTL3 phase separation. PLoS Biol. 20, e3001535 (2022).
Wang, X. et al. A photoregulatory mechanism of the circadian clock in Arabidopsis. Nat. Plants 7, 1397–1408 (2021).
Ries, R. J. et al. m(6)A enhances the phase separation potential of mRNA. Nature 571, 424–428 (2019).
Gao, Y. et al. Multivalent m(6)A motifs promote phase separation of YTHDF proteins. Cell Res. 29, 767–769 (2019).
Alarcon, C. R., Lee, H., Goodarzi, H., Halberg, N. & Tavazoie, S. F. N6-methyladenosine marks primary microRNAs for processing. Nature 519, 482–485 (2015).
Bhat, S. S. et al. mRNA adenosine methylase (MTA) deposits m(6)A on pri-miRNAs to modulate miRNA biogenesis in Arabidopsis thaliana. Proc. Natl Acad. Sci. USA 117, 21785–21795 (2020).
Alarcon, C. R. et al. HNRNPA2B1 is a mediator of m(6)A-dependent nuclear RNA processing events. Cell 162, 1299–1308 (2015).
Murakami, S. & Jaffrey, S. R. Hidden codes in mRNA: control of gene expression by m(6)A. Mol. Cell 82, 2236–2251 (2022).
Zhang, H. et al. A comprehensive online database for exploring approximately 20,000 public Arabidopsis RNA-seq libraries. Mol. Plant 13, 1231–1233 (2020).
Arribas-Hernandez, L. & Brodersen, P. Occurrence and functions of m(6)A and other covalent modifications in plant mRNA. Plant Physiol. 182, 79–96 (2020).
Erdos, G., Pajkos, M. & Dosztanyi, Z. IUPred3: prediction of protein disorder enhanced with unambiguous experimental annotation and visualization of evolutionary conservation. Nucleic Acids Res. 49, W297–W303 (2021).
Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021).
Evans, R. et al. Protein complex prediction with AlphaFold-Multimer. Preprint at bioRxivhttps://doi.org/10.1101/2021.10.04.463034 (2022).
Wang, X. et al. Structural basis of N(6)-adenosine methylation by the METTL3–METTL14 complex. Nature 534, 575–578 (2016).
Bose, M., Lampe, M., Mahamid, J. & Ephrussi, A. Liquid-to-solid phase transition of oskar ribonucleoprotein granules is essential for their function in Drosophila embryonic development. Cell 185, 1308–1324 e1323 (2022).
Lu, S. et al. Heat-shock chaperone HSPB1 regulates cytoplasmic TDP-43 phase separation and liquid-to-gel transition. Nat. Cell Biol. 24, 1378–1393 (2022).
Cheng, S. et al. Mammalian oocytes store mRNAs in a mitochondria-associated membraneless compartment. Science 378, eabq4835 (2022).
Zhong, S. et al. Anaphase-promoting complex/cyclosome regulates RdDM activity by degrading DMS3 in Arabidopsis. Proc. Natl Acad. Sci. USA 116, 3899–3908 (2019).
Dominissini, D. et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485, 201–206 (2012).
Speth, C. et al. Arabidopsis RNA processing factor SERRATE regulates the transcription of intronless genes. eLife 7, e37078 (2018).
Wang, Z. et al. SWI2/SNF2 ATPase CHR2 remodels pri-miRNAs via SERRATE to impede miRNA production. Nature 557, 516–521 (2018).
Gonzalo, L. et al. R-loops at microRNA encoding loci promote co-transcriptional processing of pri-miRNAs in plants. Nat. Plants 8, 402–418 (2022).
Bajczyk, M. et al. SERRATE interacts with the nuclear exosome targeting (NEXT) complex to degrade primary miRNA precursors in Arabidopsis. Nucleic Acids Res. 48, 6839–6854 (2020).
Scutenaire, J. et al. The YTH ___domain protein ECT2 is an m(6)A reader required for normal trichome branching in Arabidopsis. Plant Cell 30, 986–1005 (2018).
Wei, L. H. et al. The m(6)A reader ECT2 controls trichome morphology by affecting mRNA stability in Arabidopsis. Plant Cell 30, 968–985 (2018).
Arribas-Hernandez, L. et al. Principles of mRNA targeting via the Arabidopsis m(6)A-binding protein ECT2. eLife 10, e72375 (2021).
Mogk, A., Bukau, B. & Kampinga, H. H. Cellular handling of protein aggregates by disaggregation machines. Mol. Cell 69, 214–226 (2018).
Tyedmers, J., Mogk, A. & Bukau, B. Cellular strategies for controlling protein aggregation. Nat. Rev. Mol. Cell Biol. 11, 777–788 (2010).
Zhang, G., Wang, Z., Du, Z. & Zhang, H. mTOR regulates phase separation of PGL granules to modulate their autophagic degradation. Cell 174, 1492–1506 e1422 (2018).
Zheng, H., Peng, K., Gou, X., Ju, C. & Zhang, H. RNA recruitment switches the fate of protein condensates from autophagic degradation to accumulation. J. Cell Biol. 222, e202210104 (2023).
Liu, J. et al. A METTL3–METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat. Chem. Biol. 10, 93–95 (2014).
Zhang, X., Henriques, R., Lin, S. S., Niu, Q. W. & Chua, N. H. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 1, 641–646 (2006).
Jia, J. et al. Post-transcriptional splicing of nascent RNA contributes to widespread intron retention in plants. Nat. Plants 6, 780–788 (2020).
Zhang, X. et al. A comprehensive map of intron branchpoints and lariat RNAs in plants. Plant Cell 31, 956–973 (2019).
Zhang, Z. et al. KETCH1 imports HYL1 to nucleus for miRNA biogenesis in Arabidopsis. Proc. Natl Acad. Sci. USA 114, 4011–4016 (2017).
Sun, D., Ma, Z., Zhu, J. & Zhang, X. Identification and quantification of small RNAs. Methods Mol. Biol. 2200, 225–254 (2021).
Ma, Z. et al. Arabidopsis SERRATE coordinates histone methyltransferases ATXR5/6 and RNA processing factor RDR6 to regulate transposon expression. Dev. Cell 45, 769–784 e766 (2018).
Li, Y., Sun, D., Yan, X., Wang, Z. & Zhang, X. In vitro reconstitution assays of Arabidopsis 20S proteasome. Bio Protoc. 11, e3967 (2021).
Zhu, H. et al. Bidirectional processing of pri-miRNAs with branched terminal loops by Arabidopsis Dicer-like1. Nat. Struct. Mol. Biol. 20, 1106–1115 (2013).
Su, R. et al. METTL16 exerts an m(6)A-independent function to facilitate translation and tumorigenesis. Nat. Cell Biol. 24, 205–216 (2022).
Su, S. et al. Cryo-EM structures of human m(6)A writer complexes. Cell Res. 32, 982–994 (2022).
Acknowledgements
This work was supported by grants from the National Institutes of Health (NIH, GM127414) and National Science Foundation (NSF, MCB 1818082) to B.Y., the NSF of Guangdong Province (2020B1515020007), the NSF of China (NSFC, 31771349, 32170593) and the Guangdong Provincial Pearl River Talent Plan (2019QN01N108) to Z.Z., and the NIH (R35GM151976), NSF (MCB 2139857) and the Welch Foundation (A-2177-20230405) to X.Z.
Author information
Authors and Affiliations
Contributions
X.Z. and S.Z. conceived the project and designed the experiments. Z.Z. and B.Y. independently discovered the project of SE–MTB interaction. S.Z. performed most of the experiments. X.L. generated genetic materials and plasmids and participated in confocal microscope analysis. Jiyun Zhu and T.M. performed HPLC–MS and data analysis. C.L. analysed MeRIP-seq and sRNA-seq data. H.B. and J.C. generated MTA and MTB antibodies and validated partial results. L.G. created lines of Flag-tagged conjugated MTA and MTB overexpression transgenic plants and native promoter-driven GFP-tagged MTB, with either Col-0 or se-1 background. Jiaying Zhu, T.O. and N.L. contributed to in vitro RNA transcription. X.Y. participated in protein purification. H.K. and X.P. provided intellectual and experimental support. S.Z. wrote the initial draft of the paper, X.Z. thoroughly edited the paper and all authors contributed to the proofreading.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Cell Biology thanks Jungnam Cho, Monika Chodasiewicz, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Extended data
Extended Data Fig. 1 Pan-transcriptome network association analysis reveals obvious association of the expression patterns between SE and m6A RNA methylation writers.
a, b, Pan RNA-seq network analysis showed synchronous expression association of microprocessor components and m6A writers over all samples (a), or across different tissues (b). Spearman (or Pearson) correlation analysis was conducted to assess the expression relationship using over 1,000 RNA-seq data from various wild-type plant tissues. The house keeping gene ACTIN1 (AT2G37620) serves as a control. Each point in (a) represents expression levels of two indicated genes shown in log10(FPKM) in individual RNA-seq datasets. In (b), R values, Spearman R correlation. P values for small, medium and large cycles are 0.33, 0.1 and 0.001, respectively. Unpaired two-sided t-test.
Extended Data Fig. 2 Experimental validation of the genetic association between SE and MTC in developmental processes, modulation of gene expression, and protein-protein interactions.
a, Design of artificial miRNAs (mta-a, -b, mtb, and fip37). The sequence alignment of the artificial miRNAs (in red) with their target sequences (in blue). Be noted: two independent artificial-miRNA lines for MTB and FIP37 were generated and validated. One elite line for each was used for further studies. b – d, RT-qPCR assays showed that the amount of MTA, MTB and FIP37 transcripts was largely reduced in knockdown lines of mta (b), mtb (c), and fip37 (d) vs Col-0 and se-2, respectively. Data are mean ± s.d. of three independent experiments. P values, one-way ANOVA analysis with Dunnett’s multiple comparisons test. For (b), p values for relative expression of MTA at the se-2, mta-a, and mta-b vs Col-0 are 0.23, < 0.0001, and < 0.0001, respectively. For (c), p values for relative expression of MTB at the se-2 and mtb vs Col-0 are 0.98 and 0.0013, respectively. For (d), p values for relative expression of FIP37 at the se-2 and fip37 vs Col-0 are 0.99 and 0.0010, respectively. e, f, Western blots showed the reduced MTA (e) and MTB (f) proteins in their amiR-KD lines. Endogenous proteins were detected by indicated antibodies, respectively. HSP70 was a loading control. g, Knockdown lines of mta, mtb, and fip37 displayed developmental defects in seedlings. The photos were taken of 10-day-old seedlings, with Col-0 and se-2 serving as controls. Scale bars, 1 cm. h, Y2H screening showed that neither DCL1 nor HYL1 directly interact with m6A writers. 1:5 serial dilutions are shown. -LT, lacking Leu and Trp; -LTHA, lacking Leu, Trp, His and Ade. i, LCI assays in Nicotiana Benthamiana demonstrated that both MTB and FIP37 can mediate the interaction between MTA and SE. CPM: Count per minute j – l, Co-IP assays validated the interaction between SE and MTC in plants. Proteins were extracted from transgenic plants of p35S::Flag-MTA (j), p35S::Flag-MTB (k), and p35S::Flag-4xMyc-FIP37 (l) transgenic plants, respectively. Lysates were then supplied with or without 50 μg/mL of RNase A prior to IP with an anti-FLAG antibody. SE was detected via a specific anti-SE antibody. HSP70 serves as a negative control. m, BiFC assays validated the interactions between SE and MTC in Arabidopsis mesophyll protoplast. PAG1 serves as a positive control. and showed similar results. Scale bar, 10 μm. At least three independent experiments were performed (e, f, i, j, k, and l), ten transgenic plants exhibited were photographed (g), ten independent colonies (h) and ten independent protoplasts for each interaction were tested (m), and representative images are shown.
Extended Data Fig. 3 MeRIP-Seq shows different m6A epi-transcriptome profiling of Poly(A) + RNA in se and mta vs Col-0.
a, HPLC-MS quantification of m6A/A levels of commercial m6A (+) and m6A (–) spike-ins, GLuc (m6A/A, ~20%) and CLuc, respectively. Data are mean ± s.d. of three independent experiments. b, Schematic approach for MeRIP-Seq. Briefly, the purified poly(A) + RNA was mixed with internal controls containing m6A modified (red) and unmodified (yellow) spike-ins, and then fragmented. The resulting fragments were immunoprecipitated using a specific anti-m6A antibody. Parallel IPs using an anti-GFP antibody were performed as negative controls. The IP-ed RNAs were then processed for library construction and high-throughput sequencing, enabling the identification and quantification of m6A modifications at a transcriptome-wide level. c, Autography images of input and m6A RNA enriched by indicated antibodies in (b). One tenth of the input and all of immunoprecipitated RNA were de-phosphorylated and then labelled with P32-ATP before resolvement in 8% urea gels. d, The motif sequences for m6A modifications in the context.
Extended Data Fig. 4 Computational simulation reveals that the IDR regions of SE and MTB mediate the protein-protein interaction.
a – f, Computational simulation via IUPred3 (a – c) and AlphaFold2 (d – f) showed disorder regions of animal (a, b) and plant m6A writers (c – e), and plant SE (f). For IUPred3 analysis, a window size of 30 consecutive residues was used. The predicted disordered and ordered regions are presented in red and blue, respectively. The left y-axis represents the tendency score, while the x-axis represents positions of amino acids. ZF, zinc finger; MTD, methyltransferase ___domain. g, h, 3D models of heterotypic assembly, including a human-MTC mimicking structure of MTA-MTB (g), and an IDR-coupled folding model of SE-MTB (h). Both models were predicted via the multimer module of AlphaFold2. The different entities are color-coded as indicated. In (h), the N-terminal IDR of MTB wrapped around the C-terminal IDR of SE to create a pivotal interaction interface which served as the nexus of the MTB-SE assembly, which was further stabilized by the N-terminal IDR of SE clasping MTB. Furthermore, the MTase ___domain of MTB and the zinc finger ___domain of SE maintained a functionally active conformation like that of MTC or the monomer, respectively. i, Sequence alignment of C-terminal of SE and its homologs across different species showed that R718 is conserved through plants. Predicted seven donors of hydrogen bonds in the SE-MTB interaction were highlighted in dashed boxes.
Extended Data Fig. 5 MTA and MTB show liquid-liquid phase separation only in the presence of SE.
a, Coomassie Brilliant Blue (CBB) staining of purified recombinant proteins for in vitro assays in SDS–PAGE gels. b, In vitro droplet formation of 3 μM purified mCherry-SE, mCherry-SE-R718A, mCherry-SE∆IDR1, and mCherry-LCDFUS-SE∆IDR1. c, Recombinant MTB protein formed aggregates when dialyzed from high salt solution (800 mM) into a low salt (150 mM) solution. d, In vitro assays with 3 μM MTA-CFP indicated that the presence of the crowder 5% Ficoll resulted in insoluble condensates resistant to 10% 1,6-HD. e, In vitro condensate formation assays indicated that the removal of the fluorescent tag had no impact on the phase behavior of either MTA or MTB. f, Confocal images shows no co-condensates formed by LCDFUS and MTB in vitro. g, Confocal images showed co-condensation of MTA-CFP and YFP-MTB with or without 5% Ficoll. h, Rendered 3D shapes of SE-MTB co-condensates. i – m, Confocal images revealed that transiently expressed MTA-CFP, YFP-MTB, and mCherry-SE in Arabidopsis mesophyll cells from Col-0 display liquid-like co-condensates. In (i), overlapped signals were observed. In (j), rendered 3D modeling reveals that co-condensates exhibit a spherical shape. In (k), fusion of co-condensates is presented with time-lapse live imaging. In (l, m), FRAP assays and the recovery curve showed that MTC displays liquid-like phase behavior. Data are mean ± s.d. of eight independent experiments. n, Confocal microscopic images showed the fluorescence of transiently expressed proteins in Arabidopsis mesophyll protoplast prepared from se-1. Be noted that SE and LCDFUS-SE∆IDR1, but not SE-R718A and SE∆IDR1, formed liquid-like co-condensates with MTA and MTB in protoplasts. 2.5% 1,6-HD treatment was adopted 10 min prior before imaging which disrupted liquid-like condensates. For (a, b, f, and n), SE∆IDR1, plant SE depleting N-terminal IDR; LCDFUS- SE∆IDR1 is a chimera protein of human FUS’s LCD and SE∆IDR1; FUSLCD, human FUS’s LCD without SE∆IDR1. Scale bars, 10 μm (b, d – g), 5 μm (h, n), and 2.5 μm (i, j, k, and l). At least three independent experiments were performed (a – h), at least eight independent protoplasts were tested (i – n), and representative images are shown.
Extended Data Fig. 6 SE regulates the phase behaviors of MTC in plants.
a – d, Confocal images (a) and FRAP assays (b – d) revealed that SE and MTC have similar phase behaviors when transiently expressed via (a, b, upper panels, and c) 35S and (a, b, bottom panels, and d) their native promoters in N. benthamiana. Data are mean ± s.d. of at least eight independent experiments. e, FRAP assays showed that SE and MTB condensates undergo phase transition from liquid-like to a gel- or solid- like behavior upon 1,6-HD treatment that blocks the signal recover after bleaching. Regions of interest were labelled with white circles. f, g, Confocal images (f) and statistical analysis (g) revealed the decreased MTB signal in se-1 vs Col-0. In (g), counting mode was used to analyse detectable photon for normalization. Data are mean ± s.d. of sixteen independent experiments. P value is < 0.0001, an unpaired two-sided t-test. h, Immunoblots with three-week-old plants detected the proteins in indicated fractions extracted from se-2 and se-3 vs Col-0. i, RNA-seq53 analysis exhibited that increased expression of MTB in ten-day-old seedling in se-2 vs Col-0. Data are mean ± s.d. of three independent replicates. P value is 0.011, an unpaired two-sided t-test. j, Two biological replicates of immunoblots with ten-day-old seedling detected a decreased ratio of soluble (supernatant) MTB in se-2 vs Col-0 where the amount was arbitrarily assigned a value of 1. Scale bars, 2.5 μm (a, b, e, andf). At least eight (a, b, ande), sixteen (f), and three (h, j) independent experiments were performed, and representative images are shown.
Extended Data Fig. 7 SE stabilizes MTB by preventing 20S-proteasome-mediated degradation in plants.
a – c, MTB-decay assays. Immunoblot assays showed that different protein stabilities of the plant MTB protein (a) and purified recombinant MTB protein (b) in the presence of the indicated reagents. The statistical analysis (c) of left-over MTB in (b). CHX, cycloheximide, 0.5 mM; MG-132, 50 μM; PYR-41, 50 μM. Only the comparisons with the Col-0 (DMSO) group are shown. P values for se-2 (MG-132) and se-2 (DMSO) vs Col-0 (DMSO) are 0.97 and < 0.0001, respectively. Two-way ANOVA analysis with Tukey’s multiple comparisons test results. See also supplementary table 4 for detailed comparisons. d, e, Y2H (d) and BiFC assays (e) showed interactions between MTB and 20S proteasome subunits, including PAG1, PBE1, and PBE2. In (d), negative controls for Fig. 4h (1:10 serial dilutions) are shown. SD-LT, synthetic defined medium lacking Leu and Trp; -LTHA, lacking Leu, Trp, His and Ade. f, RNA-seq15 analysis showed the expression level of m6A writers in pag1 vs Col-0. Data are mean ± s.d. of three biological replicates. P values for MTA, MTB, FIP37, and SE at pag1-2 vs Col-0 are 1.00, 0.99, 0.99, and 1.00, respectively. Unpaired two-sided t-test. g, Overexpression of MTA in Col-0 and se-1 could promote flowering time whereas overexpression of MTB could only do this in Col-0, but not in the se-1 background. h, MTB-interaction compromised or IDR-depleted SE variants could not complement the developmental defects of se-1. 6As-SE, in which all potential hydrogen donors in C-terminal were mutated except R718; SE-R718A, which has compromised interaction with MTB; SE∆IDR1, which lacks the N-terminal IDR, failed to form spherical co-condensates; LCDFUS-SE∆IDR1, a chimera protein of human FUS’s LCD fused with SE∆IDR1, exhibits a pattern analogous to wild-type SE. Three-week-old plants were imaged. Scale bars, 10 μm (e), 5 cm (g), 1 cm (h). Three independent experiments (a, b) were performed, at least 10 independent colonies and protoplasts for each interaction were tested (d, e), at least ten transgenic plants showed similar phenotype (g, h), and representative images are shown.
Extended Data Fig. 8 MTC promotes miRNA production.
a, Linear regression analysis did not detect significant correction between expression and methylation profiles of methylated pri-miRNAs identified by exomePeak2 in se-2. b, Statistical analysis showed that enrichment efficiencies of m6A (+) vs m6A (–) spike-ins were inversely correlated with the endogenous m6A levels in m6A-IP-qPCR. Enrichment efficiency of methylated spikes was divided by the one of unmethylated spikes in individual samples and then normalized to that of Col-0 in which the value was arbitrarily set as 1. P values for relative enrichment of standards at se-2 and mta are 0.040 and 0.0001, respectively. c – f, Bar graphs showed that reduction of miRNA (c, d), accumulation of miRNA target transcripts (e) and pri-miRNAs (f) in indicated plants. In (c), our sRNA-seq results and public sRNA-seq24 were exhibited in parallel. In (d), small RNA RT-qPCR analysis of indicated miRNAs. In (e), RNA-seq analysis of miRNA target genes. In (f), RT-qPCR analysis of pri-miRNAs. U6 and UBQ10 served as internal controls for normalization of miRNAs in (d) and pri-miRNAs in (f), respectively. For (c), p values for relative expression of miR156, miR158, miR159, miR164, miR166, miR167, miR171, miR319, and miR161.1, at the sRNA-seq of mta; pABI3::MTA vs Col-0 are 0.15, 0.12, 0.0004, 0.0002, 0.014, 0.0023, 0.0008, 0.0035, and 0.37, at the sRNA-seq mta-a vs Col-0 are 0.16, 0.081, 0.038, 0.10, 0.019, 0.057, 0.0013, < 0.0001, and 0.43, respectively. For (d), p values for relative expression of miR158, miR164, miR166, miR167, miR171, miR319 are all < 0.0001, for miR156 and miR161.1, at mta vs Col-0 are 0.014 and 0.86, at mtb vs Col-0 are 0.76 and 0.76, at fip37 vs Col-0 are 0.87 and 0.87, at se-2 vs Col-0 are both < 0.0001, respectively. For (e), p values for relative expression of genes at mta vs Col-0 are 0.0010, < 0.0001, 0.052, < 0.0001, 0.10, 0.015, 0.060, < 0.0001, 0.0003, 0.034, 0.053, 0.0011, and 0.019, at se-2 vs Col-0 are < 0.0001, < 0.0001, < 0.0001, 0.0003, 0.0037, 0.015, 0.018, 0.018, 0.027, 0.043, 0.061, 0.066, and 0.090, respectively. For (f), p values for relative expression of pri-miRNAs at mta vs Col-0 are 0.0017, 0.0015, < 0.0001, < 0.0001, 0.0047, 0.035, 0.015, and 0.0059, at se-2 vs Col-0 are 0.0012, < 0.0001, < 0.0001, < 0.0001, 0.0015, 0.0054, < 0.0001, and < 0.0001, respectively. g, h, MTA does not impact the transcription of MIR167a locus. Both histochemical staining analysis (g) and RT-qPCR of GUS activity (h) showed comparable transcriptional levels of MIR167a in mta vs Col-0. Two-week-old seedlings were analyzed. Scale bar, 0.5 cm. For (h), P value is 0.95. i, RT-PCR analysis showed that the patterns of pri-miRNA alternative splicing are comparable in Col-0 and mta. j, RNA-seq analysis showed that the transcript levels of microprocessor components are not decreased in mta vs Col-0. P values for relative expression of miRNA pathway genes at mta vs Col-0 are 0.018, 0.98, 0.69, 0.019, 0.71, 0.082, 0.99, 0.88, 0.69, and 0.12, at se-2 vs Col-0 are 0.0038, 0.99, 0.74, < 0.0001, 1.00, 0.0001, 0.11, 0.84, 0.68, and 0.24, respectively. The experiments were replicated three times and representative results are shown (i, g). Data are mean ± s.d. of three independent experiments (b – f, h, and j). P values, one-way (b) and two-way (c – e, and j) ANOVA with Dunnett’s multiple comparison test, and unpaired two-sided t-test (f, h).
Extended Data Fig. 9 MTC enables co-transcriptional processing of pri-miRNAs.
a, Comparation of public SE ChIP-seq36 and our MeRIP-seq on MIRNA revealed that SE is remarkably enriched in the loci that yield methylated pri-miRNAs. b, EMSA showed that FIP37’s RNA affinity is much weaker than that of MTB. The experiments were replicated three times and a representative result was shown. c – e, H3-RIP-qPCR assays detected increased retention of different fragments of tested pri-miRNAs along MIRNA loci in the indicated mutants vs Col-0. Be noted that defective processing of pri-miRNAs was observed with pri-miR166B (c), pri-miR168A (d), and pri-miR402 (e) in the mutants vs Col-0. IP with IgG serves as a negative control. A, B, and C refer to 5’ flanking, pre-miRNA, and 3’ flanking sequences of pri-miRNA as indicated in Fig. 6n. Data are mean ± s.d. of three independent experiments. P values, two-way ANOVA with Tukey’s multiple comparison test. For (c), p values for relative enrichment of A vs B, B vs C, and A vs C at Col-0 are 0.0034, 0.038, and 0.55, at mta are 0.22, 0.98, and 0.54, at mtb are 0.98, 0.99, and 0.99, at se-2 are 0.98, 0.85, and 0.75, at IgG control are 0.0034, 0.24, and 0.14, respectively. For (d), p values for relative enrichment of A vs B, B vs C, and A vs C at Col-0 are 0.022, 0.048, and 0.95, at mta are 0.58, 0.91, and 0.74, at mtb are 0.74, 0.93, and 0.99, at se-2 are 0.14, 0.60, and 0.90, at IgG control are 0.53, 0.58, and 0.45, respectively. For (e), p values for relative enrichment of A vs B, B vs C, and A vs C at Col-0 are < 0.0001, 0.0047, and 0.57, at mta are 0.88, 0.66, and 0.75, at mtb are 0.088, 0.93, and 0.093, at se-2 are 0.79, 0.72, and 0.072, at IgG control are 0.45, 0.74, and 0.63, respectively.
Extended Data Fig. 10 Plant m6A readers ECT2 can facilitate pri-miRNA processing via binding to m6A sites whereas inhibiting the processing when binding to structured region of pri-miRNAs.
a, IP-MS39 analysis identified several m6A readers in the SE immunoprecipitates. b, Pan RNA-seq network analysis showed the expression profiles of Arabidopsis m6A readers across various tissues. c, Y2H assays showed that ECT2 interacts with SE, but not with HYL1 nor DCL1. At least 10 independent colonies tested for each interaction. 1:10 serial dilutions are shown. SD-LT, synthetic defined medium lacking Leu and Trp; -LTHA, lacking Leu, Trp, His and Ade. d, RT-qPCR analysis showed that the expression level of some pri-miRNAs was increased in the ect2; ect3; ect4 triple mutant vs Col-0. Data are mean ± s.d. of three biological replicates. P values, unpaired two-sided t-test. P values for indicated genes at ect2; ect3; ect4 vs Col-0 are < 0.0001, 0.0145, 0.99, < 0.0001, and 1.00, respectively. e, CBB staining of purified recombinant ECT2 and ECT2-W521A in SDS-PAGE. f, g, EMSA assays showed the capacities of ECT2 (f) and ECT2-W521A (g) binding to different substrates. For ssRNA substrates, oligonucleotides were synthesized with the context GA(m6A)CAUAGAAAGAGAGAGAUAUAAA carrying a m6A locus and an identical sequence without m6A. Structured RNAs were folded prior to binding assays. The experiments were replicated three times and representative results are shown. h, Illustration and sequence of structured RNAs used in EMSA. i – l, The binding curves of ECT2 and ECT2-W521A to structured RNAs in (f, g). The Kd values were calculated from the EMSA images quantification with s.d. from three experiments, ECT2 and m6A (–) URURU (+) structured RNA (i), ECT2 and m6A (–) URURU(–) structured RNA (j), ECT2-W521A and m6A (–) URURU (+) structured RNA (k), and ECT2-W521A and m6A (–) URURU(–) structured RNA (l). Be noted that ECT2 has clearly higher binding affinity to m6A-substrates than m6A-lacked substrates. See also Fig. 7 for Kd of ECT2 / ECT2-W521A and m6A (+) URURU (+) structured RNA. Data are mean ± s.d. of three biological replicates. m, Illustration and sequence of m6A (+) pri-miR166A used in the processing assay.
Supplementary information
Supplementary Information
Supplementary Fig. 1.
Supplementary Tables 1–4 and 6
Bioinformatic analysis of multi-omics data (pan-transcriptome, RNA-seq, MeRIP-seq and sRNA-seq) and statistical analysis of protein degradation assays.
Supplementary Tables 5 and 7.
Lists of methylated pr-miRNAs and used oligos in this study.
Source data
Figs. 1 and 3–8 and Extended Data Figs. 2, 3 and 6–10.
Unprocessed western blots and gels.
Figs. 1–8 and Extended Data Figs. 1–10.
Source numerical data and statistical source data.
Rights and permissions
Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.
About this article
Cite this article
Zhong, S., Li, X., Li, C. et al. SERRATE drives phase separation behaviours to regulate m6A modification and miRNA biogenesis. Nat Cell Biol 26, 2129–2143 (2024). https://doi.org/10.1038/s41556-024-01530-8
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/s41556-024-01530-8
This article is cited by
-
N 6-methyladenosine modifications stabilize phosphate starvation response–related mRNAs in plant adaptation to nutrient-deficient stress
Nature Communications (2025)
-
MicroRNA Biogenesis Modulates mRNA N6-methyladenosine Methylation in Arabidopsis
Journal of Plant Biology (2025)
