Abstract
Rotaviruses pose a significant threat to young children. To identify novel pro- and anti-rotavirus host factors, we performed genome-wide CRISPR/Cas9 screens using rhesus rotavirus and African green monkey cells. Genetic deletion of either SERPINB1 or TMEM236, the top two antiviral factors, in MA104 cells increased virus titers in a rotavirus strain independent manner. Using this information, we optimized the existing rotavirus reverse genetics systems by combining SERPINB1 knockout MA104 cells with a C3P3-G3 helper plasmid. We improved the recovery efficiency and rescued several low-titer rotavirus reporter and mutant strains that prove difficult to rescue otherwise. Furthermore, we demonstrate that TMEM236 knockout in Vero cells supported higher yields of two live-attenuated rotavirus vaccine strains than the parental cell line and represents a more robust vaccine-producing cell substrate. Collectively, we developed a third-generation optimized rotavirus reverse genetics system and generated gene-edited Vero cells as a new substrate for improving rotavirus vaccine production.
Similar content being viewed by others
Introduction
Rotaviruses (RVs) belong to the Sedoreoviridae family, a group of double-stranded RNA (dsRNA) non-enveloped viruses. The genome of RV consists of 11 segments (genes 1-11), which encode 6 structural proteins (VP1-4, VP6, and VP7) and 6 nonstructural proteins (NSP1-6). Although there are two vaccines available globally, i.e., Rotarix® (RV1, GSK), and RotaTeq® (RV5, Merck), RV infection results in the death of more than 128,500 children per year worldwide1, highlighting the need for more efficacious vaccines.
The first reverse genetics system for RV was described in 2006, in which a human RV strain was used as a helper virus2. The transformative plasmid-only-based reverse genetics system for RV was developed in 20173. In this system, each of 11 RV cDNAs is driven by a T7 promoter and ends with a hepatitis delta virus ribozyme sequence. The 11 rescue plasmids are transfected into BHK-T7 cells along with plasmids encoding two subunits of the vaccinia virus capping enzyme (D1R and D12L) and a Nelson Bay reovirus fusion-associated small transmembrane protein (FAST). Because RV does not replicate efficiently in BHK-T7 cells, MA104 cells, which are highly susceptible to RV infection, are used as an overlay to propagate the rescued virus. Our lab previously optimized this system by increasing the amount of the rescue plasmids of NSP2 and NSP5 proteins, components of viroplasm where RV replication occurs. We also replaced plasmids encoding vaccinia virus capping enzymes with a single plasmid C3P3-G1 (i.e. first generation of cytoplasmic chimeric capping-prone phage polymerase system) that encodes a fusion protein of African swine fever virus capping enzyme and T7 polymerase4. Furthermore, we replaced wild-type MA104 cells with MA104 N*V cells constitutively expressing bovine viral diarrhea virus N protein and parainfluenza virus 5 V protein that degrade IRF3 and STAT1, respectively. Subsequently, our lab and others have optimized the RV reverse genetics system to enable the recovery of low-titer recombinant reporter viruses and hard-to-rescue RV strains4,5,6, including simian RV4,5, human RV4,7,8, porcine RV9, and murine-like RV4. However, the limited efficiency in recovering these hard-to-rescue strains reveals a critical gap for RV reverse genetics systems. Multiple potential means to increase rescue efficiency have been recently discussed10, one of which is an optimized MA104 cell substrate for the overlaying step.
Whole genome loss-of-function CRISPR/Cas9 screens have been used to identify pro-viral host factors for RV11, influenza12, SARS-CoV-213,14, hepatitis B virus15, hepatitis C virus16, flavivirus17, and murine norovirus18, but fewer studies have focused on the anti-viral host factors. Here, we take advantage of full-genome loss-of-function CRISPR/Cas9 survival as well as cell sorting-based screens to identify both pro-viral and anti-viral host factors for RV in MA104 cells. Based on results stemming from our screening, we leveraged SERPINB1 knockout cells to create a new RV reverse genetics system, which enables the rescue of difficult-to-recover viruses. We also found that TMEM236 knockout cells support higher levels of viral replication and are thus a compelling candidate cell line for RV and other vaccine production.
Results
A fluorescence-activated cell sorting (FACS)-based CRISPR screen identified novel anti-rotavirus host factors
To permit genome-wide CRISPR/Cas9 screening for RV host dependency factors, we first packaged lentivirus expressing Cas9, transduced MA104 cells, and selected a high-performance clone (MA104-Cas9 cells). Cells were then transduced with C. sabaeus genome-wide pooled CRISPR library13 and selected with puromycin. Subsequently, the MA104 library cells were randomly divided into 4 groups, with 2 groups for mock infection and 2 groups challenged with simian RV RRV strain. Cells that were resistant to RRV-induced cytopathic effects were harvested and then amplified for sgRNA sequencing (Fig. 1A). The RNA interference Gene Enrichment Ranking (RIGER) algorithm was used to rank enriched genes, taking into account multiple different sgRNAs per gene, number of sequencing reads per gene, and the enrichment of sgRNAs compared to the uninfected pooled library. A large panel of novel host-dependency factors for RV infection were identified (Fig. 1B). However, the overall average fold change of the screen was less than 2-fold (Fig. 1C), suggesting that a better screening strategy was needed.
A Schematic flowchart for RV live/dead-based loss-of-function CRISPR screening approach. Image was created using Adobe Illustrator. B Plot of the scores of -Log10(p value) of the top hits in the screen, sorted on the x-axis by gene Rank. C Plot of the scores of Log2(fold change) of the top hits in the screen, sorted on the x-axis by gene Rank.
We next sought to perform a FACS-based screen for both pro-RV and anti-RV host factors. To achieve our goal, we made a high titer stock of a recombinant RRV that encodes a GFP reporter (rRRV-GFP)4, and optimized conditions so that more than 97% of the parental MA104-Cas9 cells were infected based on flow cytometric analysis and microscopy (Supplementary, Fig. 1A-B). Using the GFP fluorescence intensity as a surrogate for infectivity, we sorted the top 0.1% of dimmest cells and brightest cells, which represent pro-viral factors and anti-viral factors, respectively, of the MA104 library at a single cycle of RV replication, i.e., 8 h post infection (hpi) (Fig. 2A). Next, we used RIGER to identify enriched sgRNAs in sorted cells. A total of 103 anti-viral genes were identified with the cutoff of -log(p value) >1.7, sgRNA hits ≥4, and 74 pro-viral genes were identified with the cutoff of -log(p value) > 1.7, sgRNA hits ≥4 (Supplementary Data 1-2). To further investigate enriched gene functions during RV infection, the top 12 anti-viral hits were selected for subsequent studies based on their enrichment between GFP positive and GFP negative cells: SERPINB1, RHOB, PDE4C, GPR22, ADRB1, FAM8A1, KBTBD4, TMEM236, CD28, SLC7A6, ALAS1, and SPATA4 (Fig. 2B, C). Individual gene knockout MA104 cells were generated by lenti-CRISPR_v2-based lentiviral transduction with the highest scoring sgRNA (Supplementary Table 1) and puromycin selection. As expected, knockout of these genes significantly increased virus infectivity at 8 hpi (Fig. 2D and Supplementary Fig. 1C). These results indicated that we successfully identified novel genes that have anti-RV activities by using a FACS-based screen. Next, we performed a gene ontology pathway analysis, and results showed that SERPINB1 and RHOB are protein-binding activity modulators; PDE4C and ALAS1 are metabolite interconversion enzymes; GPR22 and ADRB1 are transmembrane signal receptors; CD28 is a defense/immunity protein; SLC7A6 is a transporter; FAM8A1, KBTBD4, TMEM236, and SPATA4 do not yet have well-defined functions (Fig. 2E). Overall, membrane-associated proteins were overrepresented and consistent with our experimental design of a single round of infection.
A Schematic flowchart for RV FACS-based loss-of-function CRISPR screening approach. Image was created using Adobe Illustrator. B Plot of the scores of -Log10(p value) of the top hits in the screen, sorted on the x-axis by gene Rank. C Plot of the scores of Log2(fold change) of the top hits in the screen, sorted on the x-axis by gene Rank. D Wild-type (WT) and indicated genes knockout MA104 cells were infected with rRRV-GFP (MOI = 1), and GFP signal was measured by flow cytometry analysis. E Protein function analysis by Panther Classification System. For D, experiments were repeated at least three times in triplicates. Statistical analysis: ****P < 0.0001 using one-way ANOVA with Tukey’s post hoc test.
Genetic deletion of SERPINB1 or TMEM236 genes enhanced the infectivity of multiple RV strains
To narrow down targets for in-depth characterization, we performed RT-qPCR-based viral RNA quantification and percentage of GFP positive cells at 24 hpi to measure viral antigen levels in the infected MA104 cells. SERPINB1, RHOB, PDE4C, TMEM236, and SPATA4 pooled knockout MA104 cells had the highest RV RNA and protein levels and were selected for further studies. Via crystal violet staining, we also evaluated the cytopathic effect following infection by rhesus RV RRV strain or bovine RV UK strain in different gene knockout MA104 cells at 24 hpi (Supplementary Fig. 2A). Loss of SERPINB1 or TMEM236 accelerated cell death from RV infection. Given that RV has a tissue tropism for the small intestine, we assessed the RNA levels of SERPINB1 and TMEM236 in publicly available Human Protein Atlas dataset. Interestingly, both SERPINB1 and TMEM236 are expressed at high levels in the human small intestine (Supplementary Fig. 2B). We thus focused on SERPINB1 and TMEM236 for functional analyses.
We generated single clonal SERPINB1 or TMEM236 knockout MA104 cell lines with the highest scoring sgRNAs. Due to the lack of validated antibodies to detect monkey proteins by western blot, clean knockout cells were verified by Sanger sequencing (Fig. 3A, B) and qRT-PCR primers that target the last exons of SERPINB1 and TMEM236 genes (Supplementary Fig. 3A). The growth rate of SERPINB1 and TMEM236 knockout cells was comparable to that of the wild-type cells (Supplementary Fig. 3B, C). Subsequently, we verified that RRV replication was significantly increased in SERPINB1 or TMEM236 knockout cell lines (Fig. 3C) and that plaque size was enhanced (Fig. 3D and Supplementary Fig. 4A). Intracellular viral RNA levels were also increased in knockout cells (Supplementary Fig. 4B). RRV infection was inhibited in TMEM236-overexpressing MA104 cells (Supplementary Fig. 5). We next sought to determine the replication kinetics of RRV in vitro. An increase in virus titer in knockout cells was seen as early as 8 hpi, and significantly increased at later time points, i.e., 24, and 48 hpi (Fig. 3E). To explore whether the role of these genes is specific to RRV, we expanded our analysis to the bovine RV UK and human RV WI61 strains. Disruption of SERPINB1 or TMEM236 was associated with notably increased plaque sizes (Fig. 3F, G) and virus titers for both viral strains (Fig. 3H–I, and Supplementary Fig. 6). Given that MA104 cells have endogenous monkey ACE2 that supports SARS-CoV-2 infection19, we further assessed the effect of SERPINB1 and TMEM236 on a recombinant vesicular stomatitis virus encoding the spike protein of SARS-CoV-2 (rVSV-SARS-CoV-2) infection. We found that while TMEM236 knockout increased rVSV-SARS-CoV-2 plaque size, and SERPINB1 knockout inhibited plaque formation (Supplementary Fig. 7). These results suggest that TMEM236 may broadly inhibit virus infection while the anti-viral effect of SERPINB1 is more specific to RV infection.
A, B Regions of sgRNA-targeted SERPINB1 and TMEM236 genes were amplified and examined by Sanger sequencing. WT and knockout MA104 cells were infected with RRV (C), UK (H), and WI61 (I) (MOI = 0.01) in the presence of trypsin (0.5 μg/ml) for 48 h. Viral titers were determined by plaque forming unit (PFU) assays (C) and focus forming unit (FFU) assays (H–I). Data represent the average of three experiments; error bars indicate SEM (one-way ANOVA with Tukey’s post hoc test; *P < 0.05; **P < 0. 01; ****P < 0.0001). WT and knockout MA104 cells were infected with RRV (D), UK (F), and WI61 (G) (MOI = 0.01) in the presence of trypsin (0.5 μg/ml) for 4 days. The diameter of the plaque size was determined by calculating the diameter of the plaque. Data represent the average of three experiments; error bars indicate SEM (one-way ANOVA with Tukey’s post hoc test; **P < 0.01, ****P < 0.0001). E WT and knockout MA104 cells were infected with RRV (MOI = 0.01) for indicated time points. Viral titers were measured by focus forming unit (FFU) assays. Data represent the average of three experiments; error bars indicate SEM (two-way ANOVA with Tukey’s post hoc test; ****P < 0.0001). Without indication, P > 0.05, not significant.
The efficiency of RV reverse genetics systems was improved by overlaying with the SERPINB1 knockout MA104 cells and the use of a C3P3-G3 plasmid
The translational utility of RV as an enteric viral vector is hampered by the inability to efficiently rescue reporter and low-titer RV strains, highlighting the need for a better reverse genetics system. Toward this goal, we investigated whether we could improve rescue efficiency by overlaying transfected BHK-T7 cells with genetically modified SERPINB1 or TMEM236 knockout cells instead of wild-type MA104 cells and MA104 N*V cells. As shown in Fig. 4A, the production of infectious virus particles of the prototypic simian RV SA11 strain was increased by 4-fold in BHK-T7 cell lysates after overlaying with SERPINB1 knockout cells. Another way to increase the rescue efficiency is to supply more T7 DNA-dependent RNA polymerase. Use of C3P3-G1, a fusion protein of African swine fever virus capping enzyme NP868 and T7 RNA polymerase which generates viral mRNAs having m7G-cap at their 5’-ends, has been shown to optimize the original reverse genetics system and improve efficiency3,4. A recent study showed that the C3P3-G2 system brings an engineered cytoplasmic PAPα to the target mRNA to elongate its poly(A) tail, which leads to an increase in protein expression levels of about 2.5-3 times in cultured human cells compared to the C3P3-G1 system20. Detailed characterization of the third-generation C3P3-G3 system will be published separately. We co-transfected C3P3-G1 or C3P3-G3 with a pT7 plasmid encoding RRV-NSP3-GFP, which was used for reporter virus generation. After 24 hpi, GFP signals were measured by flow cytometry analysis (Fig. 4B). Both the percentage of GFP positive cells and the mean fluorescence intensity was increased by 5-fold in C3P3-G3 prototype transfected cells as compared to the original C3P3-G1 system (Fig. 4C, D). To investigate whether the inclusion of a C3P3-G3 prototype plasmid produces more viral particles, we rescued SA11 virus by using the C3P3-G3 helper plasmid. Indeed, we observed 3-fold increase in the yield of infectious virus particles in C3P3-G3 transfection compared to C3P3-G1 (Fig. 4E), suggesting that C3P3-G3 seems to outperform C3P3-G1.
A SA11 viruses were rescued on BHK-T7 cells and then overlayed with WT, N*V, SERPINB1, and TMEM236 knockout MA104 cells. Virus titers were determined by FFU assay. B–D BHK-T7 cells were transfected with pT7-SA11-NSP3-GFP plasmid and C3P1-G1 or C3P3-G3 helper plasmids. GFP signal (B) was measured by flow cytometry, and the number of GFP positive cells (C) and fluorescence intensity (D) were analyzed with FlowJo. E SA11 viruses were rescued by co-transfected with C3P3-G1 or C3P3-G3 helper plasmids. The virus titer was determined by FFU assay. Data represent the average of three experiments; error bars of A, C, and D indicate SEM (one-way ANOVA with Tukey’s post hoc test; **P < 0.01, ****P < 0.0001). Error bars of E indicate SEM (Student’s t test; **P < 0.01). Without indication, P > 0.05, not significant.
Next, to assess whether SERPINB1 knockout cells are better than MA104 N*V cells, we compared the recovery efficiency using a fixed C3P3-G1 system. We were able to rescue challenging viruses which cannot be rescued with the previous already optimized system (Table 1), for example, a murine-like rD6/2-2 g strain with all the possible start codons of NSP6 removed and expressing a Nano-luciferase reporter (NLuc) in the NSP3 gene segment, abbreviated as rD6/2-2g-NSP6-Del-NLuc (Fig. 5A). We also successfully rescued a highly attenuated recombinant virus rSA11-RotaTeq-VP4 (human RV VP4) with an SA11 backbone encoding the VP4 gene derived from the RotaTeq vaccine strain (Table 1). Because both overlaying BHK-T7 cells with SERPINB1 knockout MA104 cells and using a C3P3-G3 plasmid increased the yield of RV by different mechanisms, we combined these two methods to create a new reverse genetics system. We directly compared the rescue efficiency of SERPINB1 knockout in combination with C3P3-G3 with the previously published methods. Consistent with prior data, our system is comparable (above 80% success rate) to Sanchez-Tacuba’s method in terms of rescuing rRRV and rD6/2-2 g, a murine-like RV strain (Table 1). In addition, our system allowed us to increase the rescue efficiency of rD6/2-2g-NSP6-Del-NLuc and rSA11-RotaTeq-VP4.
A A schematic diagram (not to scale) of a genetically engineered pT7-D6/2-NSP3 plasmid that encodes NLuc with nucleotide positions indicated in gene segment 7. For generation of an NSP6 deletion virus, four start codons of NSP6 were mutated in gene segment 11. UTR, untranslated region; P2A, self-cleaving P2A peptide gene of porcine teschovirus-1. Image was created using Adobe Illustrator. B Viral dsRNA was extracted from sucrose cushion-concentrated virus, separated on a 10% polyacrylamide gel, and then stained with ethidium bromide. The dsRNA segment numbers are indicated and the position of the engineered gene segment 7 is marked with an asterisk. C Luciferase activity of rD6/2-2 g, rD6/2-2g-NLuc, and rD6/2-2g-NSP6-Del-NLuc. MA104 cells were infected with 10-fold serially diluted rD6/2-2 g or rD6/2-2g-NLuc or rD6/2-2g-NSP6-Del-NLuc. Cells were harvested at 48 hpi and the luciferase activity was determined by Nano-Glo® luciferase assay. Results are expressed as the mean luminescence of triplicates and error bars show the SEM (two-way ANOVA with Turkey’s post hoc test, ****P < 0.0001). D, E MA104 cells were infected with rD6/2-2g-NLuc and rD6/2-2g-NSP6-Del-NLuc (MOI = 0.01) in the presence of trypsin (0.5 μg/ml) and harvested at the indicated time points. The viral mRNA level was determined by RT-qPCR assay and normalized to that of GAPDH. Virus titer was determined by FFU assay. Data are the average of three experiments, error bars indicate SEM (two-way ANOVA with Turkey’s post hoc test; ns, not significant, *P < 0.05, **P < 0.01). Without indication, P > 0.05, not significant. F, G, H Five-day-old C57BL/6 mice (n = 6, 8) were orally inoculated with 3.5 × 103 FFUs of rD6/2-2g-NLuc or rD6/2-2g-NSP6-Del-NLuc. The diarrhea rate was monitored from 1 to 8 dpi (F). Representative images of luciferase signals of NLuc-encoding RV-infected animals at 8 dpi were shown in G. Quantification of the bioluminescent signal which is expressed in photons per second per square centimeter per steradian (p/sec/cm2/sr) (H). Data are the median of experiments; error bars indicate SEM (two-way ANOVA with Turkey’s post hoc test; *P < 0.05). Without indication, P > 0.05, not significant.
NSP6 promoted the replication and virulence of murine RV in vivo
NSP6 is the least characterized RV protein. It is only 12 kDa and some RV strains do not encode NSP621. Previous studies have shown that NSP6 deletion in the simian SA11 background does not impact viral replication in vitro22 or pathogenesis in a mouse model of infection23. However, SA11 is a simian RV and has only limited replication capacity in mice, rendering determination of NSP6’s function in vivo inconclusive. Our previous work revealed that the murine-like RV, rD6/2-2 g, encoding an NLuc reporter, has all the properties of bona fide murine RVs, including fecal shedding, diarrhea development, and transmission to uninfected littermates in the same cage1. We leveraged our optimized reverse genetics system to rescue the rD6/2-2g-NSP6-Del-NLuc virus as described above. The mutations of start codons in NSP6 were confirmed in the rescued virus stocks by Sanger sequencing (Supplementary, Fig. 8). The identity of rD6/2-2g-NSP6-Del-NLuc was validated by a unique electropherotype by RNA polyacrylamide gel electrophoresis analysis (Fig. 5B) and Sanger sequencing. The edited dsRNA of RV gene segment 7 migrated similarly to rD6/2-2g-NLuc but slower than the rD6/2-2 g gene segment 7 due to the NLuc insertion (Fig. 5B). The luciferase activity in RV-infected cells was not affected by the introduction of NSP6 deletion (Fig. 5C). In addition, we determined the replication kinetics of rD6/2-2g-NSP6-Del-NLuc compared to the parental rD6/2-2g-NLuc in vitro. The intracellular mRNA levels (Fig. 5D) and virus titers (Fig. 5E) were similar to rD6/2-2g-NLuc at 24, 48, and 72 hpi, suggesting that NSP6 is not essential for RV replication in vitro, consistent with prior work22. Next, we sought to investigate the role of NSP6 in vivo. We inoculated five-day-old C57BL/6 mice with a low inoculum (3.5 × 103 FFUs) of rD6/2-2g-NLuc and rD6/2-2g-NSP6-Del-NLuc via oral gavage. We observed that about 10% of mice developed diarrhea at 2 days post infection (dpi) about 25% developed diarrhea of rD6/2-2g-NSP6-Del-NLuc virus at 3 dpi. Despite a small number of animals, the percentage of mice exhibiting diarrhea was decreased in the NSP6 deletion virus-infected animals (Fig. 5F). To measure tissue viral loads, we quantified the bioluminescence signals from days 0 to 8 post infection and observed strong luciferase in the abdominal cavity as early as 1 dpi using the in vivo imaging system, with a significant decrease at 7 and 8 dpi in the absence of NSP6 (Fig. 5G, H). Taken together, these data suggest that while NSP6 is not required for murine RV replication in vitro, it may be important for RV pathogenesis in vivo. These findings further serve as a proof-of-principle of the prowess of our new reverse genetics system.
TMEM236 knockout Vero cells supported increased production of live-attenuated RV vaccines
The very first RV vaccine Rotashield is based on RRV and was approved by the FDA in 1998. Because our data shows increased RRV replication in anti-viral gene knockout MA104 cells (Fig. 3C–E), we would like to extend our analysis to the currently two live attenuated vaccines Rotarix and RotaTeq administered worldwide24. To investigate whether SERPINB1 and TMEM236 have effects on vaccine strain propagation, we infected the wild type, SERPIBN1, and TMEM236 knockout MA104 cells with either Rotarix or RotaTeq. We found that both SERPINB1 and TMEM236 knockout supported statistically significantly increased virus titers (Fig. 6A, B). Because Vero cells are the only cell line used for vaccine production and TMEM236 has broad anti-viral activities (Supplementary Fig. 7), we next tested if we could generate a TMEM236 knockout cell line that increases vaccine output. By using the same sgRNA described above, we generated single clonal TMEM236 knockout in Vero cells (Supplementary Fig. 9). Cells were seeded in T25 flasks and then infected with RV vaccine strains Rotarix or RotaTeq. Knocking out TMEM236 increased the overall virus output by 2 to 10-fold (Fig. 6C, D). We also examined the propagation of one other vaccine strain in this specific cell line. rVSV-ZEBOV is an Ebola virus vaccine that is constructed on a vesicular stomatitis virus backbone and was recently approved by the FDA25. The infectious titer of rVSV-ZEBOV was increased by 4-fold in TMEM236 knockout Vero cells (Fig. 6E). In TMEM236 knockout cells complemented with a V5-tagged TMEM236 (Supplementary Fig. 10), RotaTeq titer was restored to that in WT cells (Fig. 6F). Taken together, these results indicate that the TMEM236 knockout Vero cell line is a promising cell line for increased vaccine production.
WT and knockout MA104 cells in T25 flask were infected with Rotarix (A) and RotaTeq (B) (MOI = 0.01) in the presence of trypsin (0.5 μg/ml) for 96 h. Viral titers were determined by FFU assays. Data represent the average of three experiments; error bars indicate SEM (one-way ANOVA with Tukey’s post hoc test; ****P < 0.0001). WT, TMEM236 knockout, and complemented (expressing V5-TMEM236 in TMEM236 knockout cells) Vero cells in T25 flask were infected with Rotarix (C), RotaTeq (D), rVSV-ZEBOV (E), and RotaTeq (F) (MOI = 0.01) in the presence of trypsin (0.5 μg/ml) for 96 h (rVSV-ZEBOV for 48 h). Viral titers were determined by FFU assays. Data represent the average of three experiments; error bars indicate SEM (one-way ANOVA with Tukey’s post hoc test; ****P < 0.0001). Without indication, P > 0.05, not significant.
Discussion
Genome-wide CRISPR/Cas9 gene disruption screens are powerful tools to discover novel biology. In this study, we performed FACS-based genome-wide loss-of-function CRISPR/Cas9 screens for a single RV replication cycle, with SERPINB1 and TMEM236 representing the strongest anti-viral genes that inhibited RV replication (Fig. 3). According to information on Human Protein Atlas, SERPINB1 and TMEM236 localize to the cell membrane, which suggests that they may inhibit virus entry. SERPINB1 also localizes to the cytoplasm and lysosome26 and may block late-stage viral replication. We also notice that TMEM236 is localized not only to the cell membrane but also to the cytoplasm (Supplementary Fig. 5). We generated SERPINB1 and TMEM236 double knockout in MA104 cells, but the virus titer was not altered compared to single gene knockout cells (Supplementary Fig. 11), suggesting that SERPINB1 and TMEM236 possibly use the same pathway to inhibit RV infection. According to gnomAD, there are at least two pre-mature stop codon mutations and several missense/inframe indels associated with the human TMEM236 gene. We can examine the biology of TMEM236 by performing rescue assays and using truncation or point mutants of TMEM236. TMEM236 is enriched in the small intestinal epithelium (Supplementary Fig. 2B), which contains enterocytes that RV predominantly targets. Therefore, TMEM236 may play a potentially important anti-viral role in vivo. Future generation of Tmem236 knockouts and/or intestinal epithelial cell-conditional knockout mice may prove helpful to evaluate this further.
There are several other interesting leads emerging from our study that also warrant further investigation. We were able to rescue a murine-like NLuc reporter virus in combination with NSP6 gene deletion with our optimized reverse genetics system. Data from our group and others show that NSP6 deletion has no effect on virus replication in vitro22, but it seems to play a role in late-stage viral pathogenesis in vivo (Fig. 5E–H). The mechanism by which NSP6 deletion limits pathogenesis and potential interaction with the host adaptive immune system will require further study. One previous study shows that SERPINB1 inhibits interferon production and promotes Senecavirus replication27. Another study shows that SerpinB1 mitigates inflammation and restricts pro-inflammatory cytokine production during influenza infection in vivo28. We found opposing results with RRV, an interferon insensitive strain, and rVSV-SARS-CoV-2 (Fig. 3 and Supplementary Fig. 7), but further delineating the mechanisms underlying enhanced replication of these strains in the absence of SERPINB1 will benefit from further exploration.
Overall, these newly identified anti-viral factors facilitated the development of a third-generation optimized rotavirus reverse genetics system and revealed gene-edited Vero cells as a novel rotavirus vaccine substrate for improving vaccine production.
Methods
Ethics statement
The present animal study was conducted upon approval of an animal protocol by the Institutional Animal Care and Use Committee (IACUC) of Washington University School of Medicine. All mice were housed in a BSL-2 barrier facility which was temperature and humidity controlled and all procedures were conducted by trained personnel and were designed to minimize animal suffering. Challenge studies with select agents were done by trained personnel with approved protocols performed within a certified BSL-2 facility at Washington University School of Medicine. All adult mice were euthanized via CO2 inhalation from a pressurized cylinder (use flow rates that displace 10 to 30 percent of the container volume each minute) and cervical dislocation. For neonatal pups, which are more resistant to euthanasia by CO2 overdose than adult animals, a secondary physical method (decapitation with a sharp pair of scissors) was used to ensure death. Both practices were simple and compliant with the American Veterinary Medical Association guidelines. On site-veterinary care was provided by the Division of Comparative Medicine (DCM) at Washington University in St Louis. All animals were allowed food and water ad libitum. DCM provided technical staff for animal husbandry.
Cell culture and viruses
MA104 cells (ATCC CRL-2378) were cultured in Medium 199 (M199, Sigma-Aldrich) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 I.U. penicillin/ml, 100 µg/ml streptomycin, and 0.292 mg/ml L-glutamine. BHK-T7 cell line was kindly provided by Dr. Ursula Buchholz (Laboratory of Infectious Diseases, NIAID, NIH, USA)29 and cultured in completed DMEM supplemented with 0.2 μg/ml of G-418 (Promega) every other passage. MA104 N*V cells were cultured in complete M199 in the presence of 3 μg/ml of puromycin and 3 μg/ml of blasticidin (InvivoGen, San Diego, CA). Vero cells were cultured in DMEM supplemented with 10% FBS.
The recombinant RV strains used in this study include rRRV-GFP, RRV, Rotarix, RotaTeq, UK, WI61, rD6/2-2 g, rD6/2-2g-NSP6-Del-NLuc, and rD6/2-2g-NLuc and were propagated in MA104 cells1,4. Prior to infection, all RV inoculates were activated with 5 μg/ml of trypsin (Gibco Life Technologies, Carlsbad, CA) for 30 min at 37 °C. rVSV-SARS-CoV-2 and rVSV-ZEBOV virus were propagated in Vero cells19,30.
Live/dead based genome-wide CRISPR-Cas9 screen
The C. sabaeus genome-wide pooled CRISPR library was used to generate heterogeneous MA104 knockout cell population as previously described13. A total of 1.6 × 108 mutagenized cells (0.8 × 108 cells for both mock and infections) were infected with RRV at a multiplicity of infection (MOI) of 1 for 48 hours. Genomic DNA was harvested from the live cells and sgRNAs were amplified for sequencing on Illumina NextSeq platform. The RIGER algorithm was used for data analysis, taking into account multiple different sgRNAs per gene, number of sequencing reads per gene, and the enrichment of sgRNAs compared to the uninfected pooled library. The core of RIGER analysis was based on gene set enrichment analysis (GSEA) which utilized weighted Kolmogorov-Smirnov (KS) statistics to test whether a predefined set of genes skewed to the top or bottom of the whole gene list31.
FACS-based genome-wide CRISPR-Cas9 screen
The C. sabaeus genome-wide pooled CRISPR library was used to generate heterogeneous MA104 knockout cell population as previously described13. A total of 1.6 × 108 mutagenized cells (0.8 × 108 cells for both mock and infections) were infected with rRRV-GFP virus at infection (MOI = 5) in serum-free medium for 8 h. The 0.1% of GFP positive and GFP negative cells were sorted with flow cytometry. Genomic DNA was harvested from the sorted cells and sgRNAs were amplified for sequencing on Illumina NextSeq platform. The RIGER algorithm was used for data analysis, taking into account multiple different sgRNAs per gene, number of sequencing reads per gene, and the enrichment of sgRNAs compared to the uninfected pooled library. A complete list of genes and scores can be found in Supplementary Data 1.
Protein function analysis was performed using the online Panther Classification System in a three-step manner: 1. uploading IDs of the genes. 2. Choosing Homo sapiens. 3. Selecting Functional classification viewed in graphic charts (Pie). After submission, ontology was selected as Protein Class.
CRISPR-Cas9 knockout cells
Single clonal knockout MA104 and Vero cells were obtained using the PX458 vector that expresses Cas9 and sgRNAs against SERPINB1 (GGCATGCTGAAAATCCACAC) and TMEM236 (CGCAACATAGGCAATAGCAC) (Supplementary Table 1). GFP positive single cells were sorted at 48 h post-transfection using BD Aria II into 96-well plates and screened for knockout based on Sanger sequencing. Pooled knockout MA104 cells were obtained by lentiviral transduction with the lenti-CRISPR_v2, psPAX2, and pMD2.G vector that expresses Cas9 and sgRNA for a minimum of 14 days under puromycin selection32. SERPINB1 gene was amplified with primers, forward primer, ACCACTACTGGAATGCACAGTT; and reverse primer, CAACGTGCAGTGCAGAGTGC. TMEM236 gene was amplified with primers, forward primer, CGAGGACAAGGAACTTGATCCCAG; and reverse primer, CCTGCCTCAGGCTCCCAAAGTGC. Then the DNA was purified with kit and sent for Sanger sequencing.
Carboxy fluorescein succinimidyl ester (CFSE) cell proliferation assay
MA104 (WT and knockout) cells were stained following a protocol of CFSE Cell Division Tracker Kit (BioLegend, 423801). The cells proliferated and were harvested at 0–96 h post labeling and analyzed by flow cytometry. The intensity of the FITC signal was shown in histogram and normalized to mode33.
Flow cytometry analyses
MA104-Cas9 cells were infected with MOI of 5 rRRV-GFP virus for 8 h or MA104 pooled knockouts were infected with MOI of 1 rRRV-GFP for 8 h. Then cells were digested with trypsin and harvested for flow analysis which was described previously34. FlowJo v10.10.
Plaque assay
Activated virus samples were serially diluted 10-fold and added to monolayers of MA104 cells for 1 h at 37 °C. Supernatant was removed and replaced with 0.1% (w/v) agarose (SeaKem® ME Agarose. Lonza) in FBS-free M199 supplement with 0.5 μg/ml of trypsin. Cultures were incubated for 3-4 days at 37 °C in a 5% CO2 incubator. Random plaques were picked by pushing the 200 μl tip through the overlay agarose, and then were propagated in MA104 cells as described above. To quantify the plaque diameter, cultures at 3~5 dpi were fixed with 10% formaldehyde and stained with neutral red. The diameter of at least 25 randomly selected plaques from 2 independent plaque assays was recorded using an ECHO microscope and then diameters were measured with the annotation tool of the microscope. The images of rVSV-SARS-CoV-2-infected Vero cells were captured by a Typhoon biomolecular imager.
Focus-forming assay
Activated virus samples from cell culture were serially diluted 10-fold and added to confluent monolayers of MA104 cells seeded in 96-well plates for 1 h at 37 °C. Inoculates were removed and replaced with M199 serum-free and then incubated for 16–18 h at 37 °C. Cells were then fixed with 10% paraformaldehyde and permeabilized with 1% Triton. Cells were incubated with rabbit hyperimmune serum to RRV strain produced in our laboratory and previously described35 and anti-rabbit HRP-linked secondary antibody. Viral foci were stained with 3-amino-9-ethylcarbazole (AEC substrate kit. Vector Laboratories) per manufacturer’s instructions and enumerated visually. Vero cells were infected with rVSV-ZEBOV and GFP positive cells were observed using an ECHO microscope.
Plasmid construction
The murine RV rescue plasmids: pT7-D6/2-VP2, pT7-D6/2-VP3, pT7-D6/2-VP4, pT7-D6/2-VP6, pT7-D6/2-VP7, pT7-D6/2-NSP1, pT7-D6/2-NSP2, pT7-D6/2-NSP3, pT7-D6/2-NSP5, pT7- RotaTeq-VP4 (the human RV VP4) and pT7-D6/2-NSP5-NSP6-Del were prepared as described previously4 while pT7-SA11-VP1 and pT7-SA11-NSP4 were originally made by Dr. Takeshi Kobayashi (Research Institute for Microbial Diseases, Osaka University, Japan)3 and obtained from Addgene. The C3P3-G1 and C3P3-G3 plasmids were kindly provided by Dr. Jais (Eukarÿs)20,36. To generate pT7-D6/2-NSP3-NLuc (accession number: ON738554), which encodes a full-length NLuc gene (GenBank: KM359774.1) and the self-cleaving P2A peptide gene of porcine teschovirus-1, the P2A-NLuc gene cassette was amplified by PCR and inserted between nucleotides in the NSP3 gene via Gibson assembly (NEBuilder HiFi DNA Assembly kit). To generate pT7-D6/2-NSP5-NSP6-Del plasmid, four start codons (sites 1, 25, 60, 65 ATG to ACG) of NSP6 were mutated to other amino acids. Lenti-V5-TMEM236 plasmid was obtained from DNASU (HsCD00936994). Purification of all the plasmids was performed using QIAGEN Plasmid Maxiprep kit per the manufacturer’s instructions.
Generation of recombinant RVs
rD6/2-2 g was generated using the following pT7 plasmids: pT7-SA11-VP1 and -NSP4, pT7-D6/2-VP2, -VP3, -VP4, -VP6, -VP7, -NSP1, -NSP2, -NSP3 and -NSP5 according to the optimized entirely plasmid-based RG system4. The pT7-D6/2-NSP3 plasmid was replaced by the pT7-D6/2-NSP3-NLuc to generate rD6/2-2g-NLuc. The pT7-D6/2-NSP3 plasmid was replaced by the pT7-D6/2-NSP3-NLuc and pT7-D6/2-NSP5 plasmid was replaced by the pT7-D6/2-NSP5-NSP6-Del combined with C3P3-G3 plasmid and overlayed with SERPINB1 knockout MA104 cells to generate rD6/2-2g-NSP6-Del-NLuc virus. rSA11-RotaTeq-VP4 was generated using the following pT7 plasmids: pT7-SA11-VP1, VP2, -VP3, -VP6, -VP7, -NSP1, -NSP2, -NSP3, -NSP4 and -NSP5. The pT7-SA11-VP4 plasmid was replaced by the pT7-RotaTeq-VP4 plasmid to generate rSA11-RotaTeq-VP4 virus. The rescued recombinant RVs were propagated for two passages in MA104 cells in a 6-well plate, and then were plaque purified twice in MA104 cells.
The optimized protocol is described as follows: 2 × 105 BHK-T7 cells were seeded into 1 well of 12-well plate with 1 ml of complete DMEM (10% heat-inactivated FBS, 100 IU/ml penicillin, 100 μg/ml streptomycin, 0.292 mg/ml) G418-free medium. Twenty four hours later, the medium was replaced by 800 μl of fresh complete DMEM medium, and then the subconfluent BHK-T7 monolayer was transfected with the corresponding transfection mix, which contained 125 μl of prewarmed Opti-MEM, 400 ng each of the 8 RV pT7 plasmid, pT7-VP1-7, pT7-NSP1,3,4 and 1200 ng pT7-NSP2,5, and 800 ng of the plasmid C3P3-G3. Then added 14 μl of TransIT-LTI (Mirus Bio LLC). All the plasmids and transfection reagents were mixed in a pipet by gently moving them up and down and then incubated at room temperature for 15 min. Transfection mixture was added drop by drop to the medium of BHK-T7 monolayers, and then the cells were returned to 37 °C. 18 h later, two washes with FBS-free medium, after that 800 μl of serum-free DMEM was added to the transfected-BHK-T7 cells. Twenty-four hours later, 5 × 104 SERPINB1 knockout MA104 in 200 μl of serum-free DMEM was added to the well, along with 0.5 μl/ml of porcine pancreatic type IX-S trypsin (Sigma-Aldrich). SERPINB1 knockout MA104 and BHK-T7 cells were cocultured for 72 h, after which they were frozen and thawed three times. To remove cell debris, the lysate was centrifuged at 350 × g for 10 min at 4 °C and then activated with 2.5 μg/ml of trypsin to infect a three-day-old monolayer of MA104 cells. After 1 h of adsorption, the inocula were removed, and 1 ml of serum-free 199 medium supplemented with 0.5 μg/ml of trypsin was placed on the cells. MA104 cells were incubated at 37 °C for 5 days or until cytopathic effects were observed (passage 1). We defined virus as successfully rescued when MA104 cells infected with the corresponding RV rescued passage 1 were positive by immunostaining using an anti-double-layered particle antibody (see section on focus-forming assay).
RT-qPCR
The total RNA of the MA104 cells infected with recombinant RRV, rD6/2-2 g, rD6/2-2g-NLuc, and rD6/2-2g-NSP6-Del-NLuc virus was extracted by TRIzol. Total RNA was reverse transcribed to cDNA using a high-capacity cDNA reverse transcription kit with RNase inhibitor (Applied Biosystems) according to the user guide. Briefly, 0.8 μg of RNA, 2 μl of 10× reverse transcription (RT) buffer, 0.8 μl of 100 mM deoxynucleoside triphosphate (dNTP) mix, 2 μl of RT random primers, 0.1 μl of RNase inhibitor, 0.1 μl of MultiScribe reverse transcriptase, and a flexible amount of nuclease-free H2O were added to the 20 μl reaction mixture. The reverse transcription thermocycling program was set at 25 °C for 10 min, 37 °C for 2 h, and 85 °C for 5 min. The expression level of housekeeping gene GAPDH was quantitated by 2× SYBR green master mix (Applied Biosystems), and NSP5 was quantitated by 2× TaqMan Fast Advanced master mix (Applied Biosystems). The primers used in this study were as follows: human GAPDH forward primer, 5′-GGAGCGAGATCCCTCCAAAAT-3′, and reverse primer, 5′-GGCTGTTGTCATACTTCTCATGG-3′; SERPINB1 forward primer, 5′-AAGGAGCTCAGCATGGTCA-3′; and reverse primer, 5′-GGGCGAGGTCTGAGTTGAGG-3′; TMEM236 forward primer, 5′-CCTGACCTACCCGTGTCTCTGG-3′; and reverse primer, 5′-ACCAGCCACACGCACCATTT-3′; and NSP5 forward primer, 5′-CTGCTTCAAACGATCCACTCAC-3′, reverse primer, 5′-TGAATCCATAGACACGCC-3′, and probe, 5′-CY5/TCAAATGCAGTTAAGACAAATGCAGACGCT/IABRQSP-3′. The y axis stands for the percentage of NSP5 mRNA levels relative to GAPDH levels.
Luciferase assay
MA104 cells seeded in 96-well plates were infected with 50 µL of 10-fold serial dilution of recombinant RVs at 37 °C for 48 h and freeze-thawed 2 times before 50 µL/well of Nano-Glo Luciferase Assay Reagent (Promega) was added per manufacturer’s instructions. After 5 minutes incubation at room temperature, relative luminosity units were measured (p/sec/cm2/sr) using a 20/20n Luminometer (Turner Biosystems).
Purification of RV particles by sucrose gradient centrifugation
RVs were concentrated by pelleting through a sucrose cushion as described37. Briefly, MA104 grown in 12-well plate were infected at an MOI of 0.01 and harvested at 72 h post infection (hpi), the viral lysates were freeze-thawed three times, and viral particles concentrated by ultracentrifugation for 1 h at 30,000 g at 4 °C. Viral pellets were resuspended in TNC buffer (10 mM Tris/HCl [pH 7.5], 140 mM NaCl, 10 mM CaCl2), extracted with genetron and the aqueous phase pelleted through a 40% sucrose cushion by centrifugation for 1 h at 30,000 g at 4 °C. The pelleted RV was resuspended with 1 mL of PBS with 100 mg/L of Ca2+ and Mg2+ and this suspension was used to perform MA104-Cas9 cells infection or to obtain genomic dsRNA profiles.
Electrophoresis of viral dsRNA genomes
Viral dsRNAs were extracted from sucrose cushion-concentrated RVs with TRIzol (Invitrogen) according to the manufacturer’s protocol and then mixed with Gel Loading Dye, Purple (6x), no SDS (NEB). Samples were subjected to PAGE (10%) for 2 h 30 min at 180 V and then stained with ethidium bromide (0.1 µg/mL) for 10 minutes and visualized by the gel documentation system (Axygen).
Immunofluorescence analysis
MA104 cells were transfected with indicated plasmids for 48 hours with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. Cells were washed three times with phosphate-buffered saline (PBS) and then fixed with 4% (wt/vol) paraformaldehyde for 15 min at room temperature. Cells were then washed three times with PBS and incubated with 0.1% Triton X-100 for 10 min. Next, 5% bovine serum albumin was used to block for 2 h. Cells were then incubated in Alexa Fluor FITC-conjugated goat anti-rabbit (V5) secondary antibodies for 2 h. Nuclei were stained with DAPI (00–4959–52, Invitrogen) for 10 min. All cells were washed with PBS 5 times after each step and were imaged by microscopy34,38.
Western blot
Vero cells expressing V5-TMEM236 were washed with cold phosphate-buffered saline (PBS) and lysed in cell lysis buffer for western blotting containing protease inhibitor cocktail (04693132001, Roche, Basel, Switzerland)34,38 by using a rabbit anti-V5 antibody (Cell Signaling Technology).
In vivo imaging system (IVIS)
C57BL/6 mice were purchased from the Jackson Laboratory and bred locally at the Washington University in St. Louis (WUSTL) CSRB vivarium. Five-day-old suckling pups were orally infected with rD6/2-2g-NLuc and rD6/2-2g-NSP6-Del-NLuc viruses (3.5 × 103 FFU). Diarrhea was evaluated from day 1 to day 8 post infection. To perform IVIS, we firstly weighed the mice, and oral gavage Nano-Glo™ substrate (1/20 dilution in PBS; to make sure 50 µL per mouse, 1/25-1/57 dilution in PBS) for 3.5 hours and then performed IVIS (exposure time: 1 second) by using the IVIS Spectrum BL.
Statistical analysis
All statistical tests were performed as described in the indicated figure legends using GraphPad Prism. Statistical significance was determined using a one-way or two-way ANOVA Tukey’s post hoc test when comparing three or more groups. A t test was performed to compare with two groups. The number of independent experiments performed is indicated in the relevant figure legends.
Data availability
The raw next-generation sequencing data are available on the NCBI ENA database under accession PRJEB75256.
References
Zhu, Y. et al. A recombinant murine-like rotavirus with Nano-Luciferase expression reveals tissue tropism, replication dynamics, and virus transmission. Front. Immunol. 13, 911024 (2022).
Komoto, S., Sasaki, J. & Taniguchi, K. Reverse genetics system for introduction of site-specific mutations into the double-stranded RNA genome of infectious rotavirus. Proc. Natl Acad. Sci. USA 103, 4646–4651 (2006).
Kanai, Y. et al. Entirely plasmid-based reverse genetics system for rotaviruses. Proc. Natl Acad. Sci. USA 114, 2349–2354 (2017).
Sanchez-Tacuba, L. et al. An Optimized Reverse Genetics System Suitable for Efficient Recovery of Simian, Human, and Murine-Like Rotaviruses. J. Virol. 94, https://doi.org/10.1128/JVI.01294-20 (2020).
Komoto, S. et al. Generation of Recombinant Rotaviruses Expressing Fluorescent Proteins by Using an Optimized Reverse Genetics System. J. Virol. 92, https://doi.org/10.1128/JVI.00588-18 (2018).
Philip, A. A. et al. Generation of Recombinant Rotavirus Expressing NSP3-UnaG Fusion Protein by a Simplified Reverse Genetics System. J. Virol. 93, https://doi.org/10.1128/JVI.01616-19 (2019).
Komoto, S. et al. Generation of Infectious Recombinant Human Rotaviruses from Just 11 Cloned cDNAs Encoding the Rotavirus Genome. J. Virol. 93, https://doi.org/10.1128/JVI.02207-18 (2019).
Kawagishi, T. et al. Reverse Genetics System for a Human Group A Rotavirus. J. Virol. 94, https://doi.org/10.1128/JVI.00963-19 (2020).
Snyder, A. J., Agbemabiese, C. A. & Patton, J. T. Production of OSU G5P [7] Porcine Rotavirus Expressing a Fluorescent Reporter by Reverse Genetics. bioRxiv, https://www.biorxiv.org/content/10.1101/2024.01.26.577454v1 (2024).
Ding, S. & Greenberg, H. B. Perspectives for the optimization and utility of the rotavirus reverse genetics system. Virus Res. 303, 198500 (2021).
Ding, S. et al. STAG2 deficiency induces interferon responses via cGAS-STING pathway and restricts virus infection. Nat. Commun. 9, 1485 (2018).
Han, J. et al. Genome-wide CRISPR/Cas9 Screen Identifies Host Factors Essential for Influenza Virus Replication. Cell Rep. 23, 596–607 (2018).
Wei, J. et al. Genome-wide CRISPR Screens Reveal Host Factors Critical for SARS-CoV-2 Infection. Cell 184, 76–91.e13 (2021).
Wei, J. et al. Pharmacological disruption of mSWI/SNF complex activity restricts SARS-CoV-2 infection. Nat. Genet. 55, 471–483 (2023).
Hyrina, A. et al. A Genome-wide CRISPR Screen Identifies ZCCHC14 as a Host Factor Required for Hepatitis B Surface Antigen Production. Cell Rep. 29, 2970–2978.e2976 (2019).
Liang, Y. et al. TRIM26 is a critical host factor for HCV replication and contributes to host tropism. Sci. Adv. 7, https://doi.org/10.1126/sciadv.abd9732 (2021).
Zhang, R. et al. A CRISPR screen defines a signal peptide processing pathway required by flaviviruses. Nature 535, 164–168 (2016).
Sullender, M. E. et al. Selective Polyprotein Processing Determines Norovirus Sensitivity to Trim7. J. Virol. 96, e0070722 (2022).
Case, J. B. et al. Replication-Competent Vesicular Stomatitis Virus Vaccine Vector Protects against SARS-CoV-2-Mediated Pathogenesis in Mice. Cell Host Microbe 28, 465–474.e464 (2020).
Le Boulch, M., Jacquet, E., Nhiri, N., Shmulevitz, M. & Jais, P. H. Rational design of an artificial tethered enzyme for non-templated post-transcriptional mRNA polyadenylation by the second generation of the C3P3 system. Sci. Rep. 14, 5156 (2024).
Mohan, K. V., Glass, R. I. & Atreya, C. D. Comparative molecular characterization of gene segment 11-derived NSP6 from lamb rotavirus LLR strain used as a human vaccine in China. Biologicals 34, 265–272 (2006).
Komoto, S. et al. Reverse Genetics System Demonstrates that Rotavirus Nonstructural Protein NSP6 Is Not Essential for Viral Replication in Cell Culture. J. Virol. 91, https://doi.org/10.1128/JVI.00695-17 (2017).
Fukuda, S. et al. Rotavirus incapable of NSP6 expression can cause diarrhea in suckling mice. J. General Virol. 103, https://doi.org/10.1099/jgv.0.001745 (2022).
McCarthy, M. Project seeks to “fast track” rotavirus vaccine. Lancet 361, 582–582, (2003).
Fausther-Bovendo, H. & Kobinger, G. The road to effective and accessible antibody therapies against Ebola virus. Curr. Opin. Virol. 54, 101210 (2022).
Wang, L. et al. Identification of SERPINB1 As a Physiological Inhibitor of Human Granzyme H. J. Immunol. 190, 1319–1330 (2013).
Yan, J. et al. SERPINB1 promotes Senecavirus A replication by degrading IKBKE and regulating the IFN pathway via autophagy. J. Virol. 97, e0104523 (2023).
Gong, D. et al. Critical role of serpinB1 in regulating inflammatory responses in pulmonary influenza infection. J. Infect. Dis. 204, 592–600 (2011).
Buchholz, U. J., Finke, S. & Conzelmann, K. K. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J. Virol. 73, 251–259 (1999).
Kang, Y. L. et al. Inhibition of PIKfyve kinase prevents infection by Zaire ebolavirus and SARS-CoV-2. Proc. Natl Acad. Sci. USA 117, 20803–20813 (2020).
Luo, B. et al. Highly parallel identification of essential genes in cancer cells. Proc. Natl Acad. Sci. USA 105, 20380–20385 (2008).
Wang, R. et al. Influenza A virus protein PB1-F2 impairs innate immunity by inducing mitophagy. Autophagy 17, 496–511 (2021).
Zeng, Q. et al. Calpain-2 mediates SARS-CoV-2 entry via regulating ACE2 levels. mBio 15, e0228723 (2024).
Zhu, Y. et al. Human TRA2A determines influenza A virus host adaptation by regulating viral mRNA splicing. Sci. Adv. 6, eaaz5764 (2020).
Feng, N. et al. Inhibition of rotavirus replication by a non-neutralizing, rotavirus VP6–specific IgA mAb. J. Clin. Investig. 109, 1203–1213 (2002).
Jais, P. H. et al. C3P3-G1: first generation of a eukaryotic artificial cytoplasmic expression system. Nucleic Acids Res. 47, 2681–2698 (2019).
Sanchez-Tacuba, L., Rojas, M., Arias, C. F. & Lopez, S. Rotavirus Controls Activation of the 2’-5’-Oligoadenylate Synthetase/RNase L Pathway Using at Least Two Distinct Mechanisms. J. Virol. 89, 12145–12153 (2015).
Zhu, Y. et al. N6-methyladenosine reader protein YTHDC1 regulates influenza A virus NS segment splicing and replication. PLoS Pathog. 19, e1011305 (2023).
Acknowledgements
We thank the members of the Ding lab for helpful discussion of the project. We thank Dr. Sean P.J. Whelan at Washington University in St. Louis who provided rVSV-SARS-CoV-2 and rVSV-ZEBOV. We thank Dr. Kristen M. Ogden at Vanderbilt University for providing Rotarix and RotaTeq. We appreciate Dr. Kenneth H. Mellits at the University of Nottingham for kindly sharing MA104 N*V cells. This study is supported by the National Institutes of Health (NIH) grants R01 AI150796 and R21 AI168490 to S.D., NIH R01 AI173360, the G. Harold and Leila Y. Mathers Foundation, and the Burroughs Wellcome Fund Investigators in the Pathogenesis of Infectious Disease award to M.T.B. R01 AI183155, R21 AI173821, P20 GM109035, the Smith Family Foundation, and Charles H. Hood Foundation to S.L.
Author information
Authors and Affiliations
Contributions
Yinxing Zhu: Conceptualization; Data curation; Formal analysis; Investigation; Visualization; Methodology; Writing the original draft; Writing—review and editing. Meagan E. Sullender: Resources. Danielle E. Campbell: Investigation. Leran Wang: Data curation. Sanghyun Lee: Investigation; Funding acquisition. Takahiro Kawagishi: Investigation; review. Gaopeng Hou: Investigation. Alen Dizdarevic: Investigation. Philippe H. Jais: Resources. Megan T. Baldridge: Resources; Writing-review and editing; Supervision; Funding acquisition. Siyuan Ding: Conceptualization; Data curation; Formal analysis; Supervision; Funding acquisition; Visualization; Methodology; Writing-review and editing; Project administration.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
About this article
Cite this article
Zhu, Y., Sullender, M.E., Campbell, D.E. et al. CRISPR/Cas9 screens identify key host factors that enhance rotavirus reverse genetics efficacy and vaccine production. npj Vaccines 9, 211 (2024). https://doi.org/10.1038/s41541-024-01007-7
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41541-024-01007-7
